Incidental Mutation 'R7999:Bak1'
ID616295
Institutional Source Beutler Lab
Gene Symbol Bak1
Ensembl Gene ENSMUSG00000057789
Gene NameBCL2-antagonist/killer 1
SynonymsN-Bak, Bak
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7999 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location27019810-27029009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27021306 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 129 (L129P)
Ref Sequence ENSEMBL: ENSMUSP00000077757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025034] [ENSMUST00000078691] [ENSMUST00000122106] [ENSMUST00000133257]
PDB Structure
STRUCTURE OF MOUSE A1 BOUND TO THE BAK BH3-DOMAIN [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025034
AA Change: S136P

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025034
Gene: ENSMUSG00000057789
AA Change: S136P

DomainStartEndE-ValueType
SCOP:d1f16a_ 15 114 2e-18 SMART
PDB:2M5B|A 18 126 1e-50 PDB
Blast:BCL 33 66 2e-10 BLAST
Blast:BCL 76 126 2e-20 BLAST
low complexity region 127 140 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078691
AA Change: L129P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077757
Gene: ENSMUSG00000057789
AA Change: L129P

DomainStartEndE-ValueType
BCL 76 175 2.2e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122106
SMART Domains Protein: ENSMUSP00000113880
Gene: ENSMUSG00000048731

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Ubiquitin_3 172 260 2.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133257
SMART Domains Protein: ENSMUSP00000115777
Gene: ENSMUSG00000048731

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
internal_repeat_1 264 280 1.14e-6 PROSPERO
Pfam:Ubiquitin_3 281 368 1.5e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143158
SMART Domains Protein: ENSMUSP00000122521
Gene: ENSMUSG00000057789

DomainStartEndE-ValueType
PDB:2YV6|A 2 64 2e-29 PDB
SCOP:d1k3ka_ 6 75 4e-14 SMART
Blast:BCL 25 64 6e-21 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form oligomers or heterodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein localizes to mitochondria, and functions to induce apoptosis. It interacts with and accelerates the opening of the mitochondrial voltage-dependent anion channel, which leads to a loss in membrane potential and the release of cytochrome c. This protein also interacts with the tumor suppressor P53 after exposure to cell stress. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,737,452 V753L probably benign Het
Ahi1 A G 10: 20,965,681 E289G probably benign Het
AI481877 G C 4: 59,094,162 F187L probably benign Het
Armc2 C T 10: 42,011,958 E10K possibly damaging Het
Aspscr1 T C 11: 120,678,522 probably null Het
B3galnt1 A G 3: 69,575,215 C238R probably damaging Het
Bdp1 A G 13: 100,058,896 F1272L possibly damaging Het
C2cd3 G A 7: 100,459,889 probably null Het
Cacna1b A T 2: 24,650,626 V1363E probably damaging Het
Capn11 T C 17: 45,639,206 N344S probably damaging Het
Ces1f A T 8: 93,262,995 V431E possibly damaging Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Defa29 A T 8: 21,326,843 S45T probably benign Het
Dnah10 A G 5: 124,725,258 D32G probably benign Het
Dnajc24 T A 2: 105,981,020 N70I probably damaging Het
Duox2 C T 2: 122,283,467 V1195I probably benign Het
E430018J23Rik T A 7: 127,392,428 S117C probably damaging Het
Enam A T 5: 88,503,702 R1023S probably benign Het
Ephx4 A T 5: 107,419,833 Q219L probably damaging Het
Eppk1 T C 15: 76,109,004 T1226A probably benign Het
Eppk1 T C 15: 76,109,135 Q1182R probably benign Het
Fiz1 A T 7: 5,008,998 S174T probably benign Het
Ggnbp1 C T 17: 27,029,645 R63C probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gsdmd T A 15: 75,863,446 I13N probably damaging Het
Gtpbp4 T C 13: 8,987,286 D292G probably damaging Het
Hnf1a A T 5: 114,960,174 L123* probably null Het
Ints11 A G 4: 155,886,956 D309G probably benign Het
Ints5 T C 19: 8,897,043 S789P probably benign Het
Jakmip2 G A 18: 43,563,333 A517V probably benign Het
Kat7 A G 11: 95,284,109 Y270H probably damaging Het
Kmt2b A G 7: 30,576,774 S1767P probably damaging Het
Lonp2 A G 8: 86,634,909 D238G probably benign Het
Lrfn3 A G 7: 30,360,024 W259R probably damaging Het
Mmrn2 G A 14: 34,397,922 D250N probably benign Het
Mre11a A T 9: 14,799,669 R49* probably null Het
Mug1 T C 6: 121,880,896 L1116P possibly damaging Het
Mup9 A G 4: 60,418,203 S234P probably benign Het
Nlrp9c A G 7: 26,385,489 F222L possibly damaging Het
Nr2e3 A G 9: 59,948,999 V85A probably damaging Het
Olfr1252 A G 2: 89,722,000 I37T probably benign Het
Prl3d2 A G 13: 27,123,966 T77A probably benign Het
Prpsap1 A T 11: 116,490,216 M1K probably null Het
Prrc2b C T 2: 32,194,414 T297M probably damaging Het
Rasa3 A G 8: 13,631,805 F48S probably benign Het
Rbm24 A T 13: 46,419,031 M1L possibly damaging Het
Ren1 C A 1: 133,354,866 T103K probably damaging Het
Rpf2 C T 10: 40,223,884 G260S probably damaging Het
Sall4 C T 2: 168,752,641 G862D probably damaging Het
Samd4 G T 14: 47,064,247 R336L probably damaging Het
Siglec1 T C 2: 131,071,163 N1611S probably benign Het
Skil A G 3: 31,097,602 H91R possibly damaging Het
Snip1 T C 4: 125,071,381 V193A probably benign Het
Sp2 A T 11: 96,961,837 I87N probably damaging Het
Syna T C 5: 134,559,192 H301R probably benign Het
Tdg A G 10: 82,641,382 K89R possibly damaging Het
Tdrd7 G A 4: 46,010,902 probably null Het
Trak1 G A 9: 121,460,425 R601H probably damaging Het
Triobp T C 15: 78,959,944 L120P probably damaging Het
Utp20 A T 10: 88,770,388 N1697K probably benign Het
Uts2r G A 11: 121,160,669 V120M possibly damaging Het
Vmn2r59 A G 7: 42,046,832 L162P probably damaging Het
Zbtb17 G A 4: 141,461,823 R18Q probably damaging Het
Zfp551 A T 7: 12,417,211 C90* probably null Het
Zfp605 T A 5: 110,128,434 C473S probably damaging Het
Zfp975 A T 7: 42,662,932 Y86N probably benign Het
Other mutations in Bak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02734:Bak1 APN 17 27020953 missense possibly damaging 0.62
R1056:Bak1 UTSW 17 27021273 missense possibly damaging 0.83
R1806:Bak1 UTSW 17 27021268 nonsense probably null
R4135:Bak1 UTSW 17 27021270 missense possibly damaging 0.66
R4422:Bak1 UTSW 17 27021324 missense probably damaging 1.00
R4664:Bak1 UTSW 17 27022536 missense possibly damaging 0.81
R5182:Bak1 UTSW 17 27022748 missense possibly damaging 0.86
R5185:Bak1 UTSW 17 27022748 missense possibly damaging 0.86
R6469:Bak1 UTSW 17 27021319 missense probably damaging 1.00
R7155:Bak1 UTSW 17 27022460 missense possibly damaging 0.82
R8086:Bak1 UTSW 17 27020937 missense probably benign 0.21
X0066:Bak1 UTSW 17 27022569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAATTCAGGGCTGCCACC -3'
(R):5'- AGACTTTCTGACCTGTCCTGG -3'

Sequencing Primer
(F):5'- AACAGGGTGGGTTATAGTGGCC -3'
(R):5'- GCAGCTTAGCCGTGTAGCTTC -3'
Posted On2020-01-23