Incidental Mutation 'R7999:Jakmip2'
ID 616298
Institutional Source Beutler Lab
Gene Symbol Jakmip2
Ensembl Gene ENSMUSG00000024502
Gene Name janus kinase and microtubule interacting protein 2
Synonyms 6430702L21Rik, D930046L20Rik
MMRRC Submission 046039-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.316) question?
Stock # R7999 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 43664472-43820838 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 43696398 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 517 (A517V)
Ref Sequence ENSEMBL: ENSMUSP00000080881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082254]
AlphaFold D3YXK0
Predicted Effect probably benign
Transcript: ENSMUST00000082254
AA Change: A517V

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080881
Gene: ENSMUSG00000024502
AA Change: A517V

DomainStartEndE-ValueType
coiled coil region 13 102 N/A INTRINSIC
coiled coil region 206 249 N/A INTRINSIC
Pfam:JAKMIP_CC3 409 602 2.3e-86 PFAM
coiled coil region 698 808 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 A G 10: 20,841,580 (GRCm39) E289G probably benign Het
Armc2 C T 10: 41,887,954 (GRCm39) E10K possibly damaging Het
Aspscr1 T C 11: 120,569,348 (GRCm39) probably null Het
B3galnt1 A G 3: 69,482,548 (GRCm39) C238R probably damaging Het
Bak1 A G 17: 27,240,280 (GRCm39) L129P probably damaging Het
Bdp1 A G 13: 100,195,404 (GRCm39) F1272L possibly damaging Het
C2cd3 G A 7: 100,109,096 (GRCm39) probably null Het
Cacna1b A T 2: 24,540,638 (GRCm39) V1363E probably damaging Het
Capn11 T C 17: 45,950,132 (GRCm39) N344S probably damaging Het
Ces1f A T 8: 93,989,623 (GRCm39) V431E possibly damaging Het
Cog3 G T 14: 75,984,533 (GRCm39) S94Y possibly damaging Het
Defa29 A T 8: 21,816,859 (GRCm39) S45T probably benign Het
Dnaaf9 C A 2: 130,579,372 (GRCm39) V753L probably benign Het
Dnah10 A G 5: 124,802,322 (GRCm39) D32G probably benign Het
Dnajc24 T A 2: 105,811,365 (GRCm39) N70I probably damaging Het
Duox2 C T 2: 122,113,948 (GRCm39) V1195I probably benign Het
Enam A T 5: 88,651,561 (GRCm39) R1023S probably benign Het
Ephx4 A T 5: 107,567,699 (GRCm39) Q219L probably damaging Het
Eppk1 T C 15: 75,993,204 (GRCm39) T1226A probably benign Het
Eppk1 T C 15: 75,993,335 (GRCm39) Q1182R probably benign Het
Fiz1 A T 7: 5,011,997 (GRCm39) S174T probably benign Het
Ggnbp1 C T 17: 27,248,619 (GRCm39) R63C probably benign Het
Gmcl1 G T 6: 86,698,408 (GRCm39) A163E probably damaging Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Gsdmd T A 15: 75,735,295 (GRCm39) I13N probably damaging Het
Gtpbp4 T C 13: 9,037,322 (GRCm39) D292G probably damaging Het
Hnf1a A T 5: 115,098,233 (GRCm39) L123* probably null Het
Ints11 A G 4: 155,971,413 (GRCm39) D309G probably benign Het
Ints5 T C 19: 8,874,407 (GRCm39) S789P probably benign Het
Kat7 A G 11: 95,174,935 (GRCm39) Y270H probably damaging Het
Kmt2b A G 7: 30,276,199 (GRCm39) S1767P probably damaging Het
Lonp2 A G 8: 87,361,537 (GRCm39) D238G probably benign Het
Lrfn3 A G 7: 30,059,449 (GRCm39) W259R probably damaging Het
Mmrn2 G A 14: 34,119,879 (GRCm39) D250N probably benign Het
Mre11a A T 9: 14,710,965 (GRCm39) R49* probably null Het
Mug1 T C 6: 121,857,855 (GRCm39) L1116P possibly damaging Het
Mup9 A G 4: 60,374,202 (GRCm39) S234P probably benign Het
Nlrp9c A G 7: 26,084,914 (GRCm39) F222L possibly damaging Het
Nr2e3 A G 9: 59,856,282 (GRCm39) V85A probably damaging Het
Or4a79 A G 2: 89,552,344 (GRCm39) I37T probably benign Het
Prl3d2 A G 13: 27,307,949 (GRCm39) T77A probably benign Het
Prpsap1 A T 11: 116,381,042 (GRCm39) M1K probably null Het
Prrc2b C T 2: 32,084,426 (GRCm39) T297M probably damaging Het
Rasa3 A G 8: 13,681,805 (GRCm39) F48S probably benign Het
Rbm24 A T 13: 46,572,507 (GRCm39) M1L possibly damaging Het
Ren1 C A 1: 133,282,604 (GRCm39) T103K probably damaging Het
Rpf2 C T 10: 40,099,880 (GRCm39) G260S probably damaging Het
Sall4 C T 2: 168,594,561 (GRCm39) G862D probably damaging Het
Samd4 G T 14: 47,301,704 (GRCm39) R336L probably damaging Het
Shoc1 G C 4: 59,094,162 (GRCm39) F187L probably benign Het
Siglec1 T C 2: 130,913,083 (GRCm39) N1611S probably benign Het
Skil A G 3: 31,151,751 (GRCm39) H91R possibly damaging Het
Snip1 T C 4: 124,965,174 (GRCm39) V193A probably benign Het
Sp2 A T 11: 96,852,663 (GRCm39) I87N probably damaging Het
Syna T C 5: 134,588,046 (GRCm39) H301R probably benign Het
Tdg A G 10: 82,477,216 (GRCm39) K89R possibly damaging Het
Tdrd7 G A 4: 46,010,902 (GRCm39) probably null Het
Trak1 G A 9: 121,289,491 (GRCm39) R601H probably damaging Het
Triobp T C 15: 78,844,144 (GRCm39) L120P probably damaging Het
Utp20 A T 10: 88,606,250 (GRCm39) N1697K probably benign Het
Uts2r G A 11: 121,051,495 (GRCm39) V120M possibly damaging Het
Vmn2r59 A G 7: 41,696,256 (GRCm39) L162P probably damaging Het
Zbtb17 G A 4: 141,189,134 (GRCm39) R18Q probably damaging Het
Zfp551 A T 7: 12,151,138 (GRCm39) C90* probably null Het
Zfp605 T A 5: 110,276,300 (GRCm39) C473S probably damaging Het
Zfp764l1 T A 7: 126,991,600 (GRCm39) S117C probably damaging Het
Zfp975 A T 7: 42,312,356 (GRCm39) Y86N probably benign Het
Other mutations in Jakmip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Jakmip2 APN 18 43,723,744 (GRCm39) utr 5 prime probably benign
IGL01311:Jakmip2 APN 18 43,690,389 (GRCm39) splice site probably benign
IGL01467:Jakmip2 APN 18 43,715,352 (GRCm39) missense probably benign 0.34
IGL01947:Jakmip2 APN 18 43,680,159 (GRCm39) missense probably benign 0.00
IGL02010:Jakmip2 APN 18 43,692,158 (GRCm39) critical splice donor site probably null
IGL02040:Jakmip2 APN 18 43,704,919 (GRCm39) missense probably benign
IGL02143:Jakmip2 APN 18 43,696,350 (GRCm39) missense probably damaging 1.00
IGL02246:Jakmip2 APN 18 43,700,223 (GRCm39) missense possibly damaging 0.82
IGL02350:Jakmip2 APN 18 43,680,192 (GRCm39) missense possibly damaging 0.46
IGL02357:Jakmip2 APN 18 43,680,192 (GRCm39) missense possibly damaging 0.46
IGL02725:Jakmip2 APN 18 43,695,655 (GRCm39) missense probably damaging 0.99
IGL02833:Jakmip2 APN 18 43,708,516 (GRCm39) splice site probably benign
IGL02866:Jakmip2 APN 18 43,685,266 (GRCm39) missense probably benign 0.28
IGL02981:Jakmip2 APN 18 43,695,595 (GRCm39) critical splice donor site probably null
R0042:Jakmip2 UTSW 18 43,685,210 (GRCm39) splice site probably benign
R0044:Jakmip2 UTSW 18 43,715,170 (GRCm39) missense probably benign
R0436:Jakmip2 UTSW 18 43,691,234 (GRCm39) nonsense probably null
R1453:Jakmip2 UTSW 18 43,692,279 (GRCm39) splice site probably null
R1682:Jakmip2 UTSW 18 43,714,896 (GRCm39) critical splice donor site probably null
R1829:Jakmip2 UTSW 18 43,715,145 (GRCm39) missense possibly damaging 0.93
R1908:Jakmip2 UTSW 18 43,700,209 (GRCm39) missense probably benign
R2070:Jakmip2 UTSW 18 43,696,395 (GRCm39) missense probably benign 0.34
R2168:Jakmip2 UTSW 18 43,698,995 (GRCm39) missense probably damaging 1.00
R2985:Jakmip2 UTSW 18 43,704,246 (GRCm39) missense possibly damaging 0.79
R3896:Jakmip2 UTSW 18 43,682,751 (GRCm39) missense probably benign 0.00
R4243:Jakmip2 UTSW 18 43,710,501 (GRCm39) missense probably benign 0.02
R4245:Jakmip2 UTSW 18 43,710,501 (GRCm39) missense probably benign 0.02
R4614:Jakmip2 UTSW 18 43,695,657 (GRCm39) missense probably damaging 1.00
R4687:Jakmip2 UTSW 18 43,710,477 (GRCm39) missense possibly damaging 0.52
R4830:Jakmip2 UTSW 18 43,700,208 (GRCm39) missense probably benign 0.00
R4852:Jakmip2 UTSW 18 43,710,465 (GRCm39) missense probably damaging 0.99
R5099:Jakmip2 UTSW 18 43,701,173 (GRCm39) missense probably benign 0.20
R5381:Jakmip2 UTSW 18 43,715,025 (GRCm39) missense probably damaging 1.00
R5753:Jakmip2 UTSW 18 43,692,181 (GRCm39) missense probably damaging 0.99
R5883:Jakmip2 UTSW 18 43,715,059 (GRCm39) missense possibly damaging 0.59
R6261:Jakmip2 UTSW 18 43,708,599 (GRCm39) missense probably benign 0.01
R6382:Jakmip2 UTSW 18 43,704,244 (GRCm39) missense possibly damaging 0.66
R6527:Jakmip2 UTSW 18 43,689,589 (GRCm39) missense possibly damaging 0.94
R6612:Jakmip2 UTSW 18 43,690,432 (GRCm39) missense probably damaging 1.00
R6679:Jakmip2 UTSW 18 43,699,014 (GRCm39) missense probably damaging 0.98
R7070:Jakmip2 UTSW 18 43,690,393 (GRCm39) critical splice donor site probably null
R7103:Jakmip2 UTSW 18 43,673,648 (GRCm39) splice site probably null
R7434:Jakmip2 UTSW 18 43,690,444 (GRCm39) missense possibly damaging 0.94
R7446:Jakmip2 UTSW 18 43,710,390 (GRCm39) missense probably damaging 1.00
R7515:Jakmip2 UTSW 18 43,704,191 (GRCm39) missense probably benign 0.01
R7586:Jakmip2 UTSW 18 43,673,676 (GRCm39) missense probably damaging 0.98
R7720:Jakmip2 UTSW 18 43,704,973 (GRCm39) missense possibly damaging 0.51
R9002:Jakmip2 UTSW 18 43,715,323 (GRCm39) missense probably benign 0.05
R9184:Jakmip2 UTSW 18 43,715,352 (GRCm39) missense probably benign 0.34
R9248:Jakmip2 UTSW 18 43,685,242 (GRCm39) missense probably benign 0.04
R9252:Jakmip2 UTSW 18 43,715,194 (GRCm39) missense possibly damaging 0.92
R9674:Jakmip2 UTSW 18 43,704,961 (GRCm39) missense probably benign
R9691:Jakmip2 UTSW 18 43,673,685 (GRCm39) missense probably damaging 0.99
R9788:Jakmip2 UTSW 18 43,704,927 (GRCm39) missense probably damaging 1.00
X0057:Jakmip2 UTSW 18 43,699,035 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CTGAGAAAGGTCACTGTGGG -3'
(R):5'- AGCATGATGACAAATGGGATCC -3'

Sequencing Primer
(F):5'- TCACTGTGGGGAGCCAAG -3'
(R):5'- CCCAGGGAAGTTTATTGAAGACTC -3'
Posted On 2020-01-23