Incidental Mutation 'R8000:Fbh1'
ID 616303
Institutional Source Beutler Lab
Gene Symbol Fbh1
Ensembl Gene ENSMUSG00000058594
Gene Name F-box DNA helicase 1
Synonyms Fbx18, Fbxo18
MMRRC Submission 046040-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.447) question?
Stock # R8000 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 11747384-11782393 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 11772100 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 194 (Y194N)
Ref Sequence ENSEMBL: ENSMUSP00000071495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071564]
AlphaFold Q8K2I9
Predicted Effect probably benign
Transcript: ENSMUST00000071564
AA Change: Y194N

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594
AA Change: Y194N

DomainStartEndE-ValueType
FBOX 213 256 3.94e-3 SMART
Pfam:UvrD-helicase 626 692 8e-10 PFAM
Pfam:UvrD_C 862 935 1.7e-12 PFAM
Pfam:UvrD_C_2 867 931 1.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A G 3: 59,924,796 (GRCm39) K121R possibly damaging Het
Acaca A G 11: 84,283,057 (GRCm39) K2208E possibly damaging Het
Actn1 A G 12: 80,245,782 (GRCm39) F134L probably damaging Het
Akt3 A T 1: 176,877,763 (GRCm39) V335D probably damaging Het
Arhgef10 T G 8: 14,980,054 (GRCm39) I98S probably damaging Het
Celf4 T C 18: 25,637,574 (GRCm39) N209S probably benign Het
Col4a4 G A 1: 82,519,018 (GRCm39) P59L unknown Het
Dmwd C T 7: 18,814,660 (GRCm39) L437F probably damaging Het
Dock4 T A 12: 40,883,118 (GRCm39) L1642I probably benign Het
Fads2b A G 2: 85,349,070 (GRCm39) V14A probably benign Het
Fap A G 2: 62,333,142 (GRCm39) probably null Het
Fras1 A G 5: 96,910,536 (GRCm39) T3322A probably damaging Het
Frey1 A G 2: 92,215,872 (GRCm39) K69E unknown Het
Gabra4 A G 5: 71,781,304 (GRCm39) F369S probably damaging Het
Igkv9-124 T A 6: 67,919,136 (GRCm39) D92V probably damaging Het
Kcna6 C A 6: 126,715,948 (GRCm39) E314* probably null Het
Kyat1 A C 2: 30,082,065 (GRCm39) S25A probably benign Het
Lars2 G A 9: 123,265,309 (GRCm39) G455D probably damaging Het
Mertk A G 2: 128,613,418 (GRCm39) H478R probably benign Het
Mier1 A T 4: 102,988,240 (GRCm39) T83S probably damaging Het
Mmp1a C A 9: 7,476,215 (GRCm39) H437Q probably benign Het
Muc4 C G 16: 32,575,221 (GRCm39) Q1269E probably benign Het
Neb G T 2: 52,178,856 (GRCm39) A1300D probably damaging Het
Nell2 T A 15: 95,333,155 (GRCm39) L167F probably damaging Het
Or10h1 G C 17: 33,418,321 (GRCm39) A100P probably damaging Het
Or12j2 T A 7: 139,916,255 (GRCm39) M160K possibly damaging Het
Or4d10c T C 19: 12,065,358 (GRCm39) D266G probably damaging Het
Pald1 T C 10: 61,183,218 (GRCm39) T339A probably benign Het
Pex13 A C 11: 23,605,915 (GRCm39) L105W probably damaging Het
Prxl2a A C 14: 40,716,483 (GRCm39) *230G probably null Het
Ptprd A C 4: 75,984,479 (GRCm39) F556V possibly damaging Het
Rgp1 T A 4: 43,581,664 (GRCm39) C314S probably benign Het
Rnaseh2a G A 8: 85,692,678 (GRCm39) probably benign Het
Rpl7 A T 1: 16,172,949 (GRCm39) M154K probably benign Het
Samd9l A T 6: 3,373,034 (GRCm39) L1409Q probably damaging Het
Slc35f3 A G 8: 127,047,812 (GRCm39) T51A probably benign Het
Slc7a10 A G 7: 34,899,865 (GRCm39) Y76C Het
Slk G T 19: 47,597,344 (GRCm39) A51S Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,222 (GRCm39) probably benign Het
Stk38 A T 17: 29,211,422 (GRCm39) V51E probably benign Het
Tecta A T 9: 42,278,480 (GRCm39) C1009* probably null Het
Vmn1r228 A T 17: 20,997,227 (GRCm39) M97K possibly damaging Het
Xpo4 T C 14: 57,827,403 (GRCm39) D931G probably damaging Het
Zfp503 T C 14: 22,036,227 (GRCm39) T230A possibly damaging Het
Other mutations in Fbh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Fbh1 APN 2 11,762,334 (GRCm39) nonsense probably null
IGL02081:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02082:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02084:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02086:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02369:Fbh1 APN 2 11,751,969 (GRCm39) missense possibly damaging 0.61
IGL02584:Fbh1 APN 2 11,764,769 (GRCm39) missense probably benign 0.07
IGL03138:Fbh1 UTSW 2 11,754,320 (GRCm39) intron probably benign
R0384:Fbh1 UTSW 2 11,754,389 (GRCm39) missense probably damaging 1.00
R0479:Fbh1 UTSW 2 11,763,230 (GRCm39) missense probably damaging 1.00
R0972:Fbh1 UTSW 2 11,768,899 (GRCm39) splice site probably benign
R1420:Fbh1 UTSW 2 11,772,493 (GRCm39) missense probably benign 0.01
R1827:Fbh1 UTSW 2 11,768,699 (GRCm39) missense possibly damaging 0.88
R1832:Fbh1 UTSW 2 11,772,211 (GRCm39) missense probably benign 0.08
R1960:Fbh1 UTSW 2 11,762,339 (GRCm39) missense probably damaging 0.98
R2040:Fbh1 UTSW 2 11,774,706 (GRCm39) missense possibly damaging 0.66
R2044:Fbh1 UTSW 2 11,767,781 (GRCm39) missense possibly damaging 0.89
R2102:Fbh1 UTSW 2 11,763,100 (GRCm39) missense probably benign 0.18
R3236:Fbh1 UTSW 2 11,774,637 (GRCm39) missense probably damaging 1.00
R3975:Fbh1 UTSW 2 11,772,021 (GRCm39) missense possibly damaging 0.72
R4504:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4505:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4507:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4799:Fbh1 UTSW 2 11,760,558 (GRCm39) missense probably damaging 1.00
R4894:Fbh1 UTSW 2 11,767,771 (GRCm39) missense probably damaging 1.00
R4994:Fbh1 UTSW 2 11,769,041 (GRCm39) missense probably damaging 1.00
R5579:Fbh1 UTSW 2 11,753,804 (GRCm39) missense probably damaging 0.97
R5801:Fbh1 UTSW 2 11,774,637 (GRCm39) missense probably damaging 1.00
R6255:Fbh1 UTSW 2 11,753,257 (GRCm39) missense probably benign 0.31
R7011:Fbh1 UTSW 2 11,767,774 (GRCm39) missense probably damaging 1.00
R7177:Fbh1 UTSW 2 11,760,522 (GRCm39) missense probably damaging 1.00
R7243:Fbh1 UTSW 2 11,756,336 (GRCm39) missense probably benign 0.11
R7331:Fbh1 UTSW 2 11,768,797 (GRCm39) missense probably benign
R7361:Fbh1 UTSW 2 11,751,887 (GRCm39) missense probably damaging 1.00
R7460:Fbh1 UTSW 2 11,761,496 (GRCm39) missense probably benign 0.38
R7541:Fbh1 UTSW 2 11,754,348 (GRCm39) missense probably benign 0.05
R8010:Fbh1 UTSW 2 11,772,443 (GRCm39) missense probably benign 0.15
R8056:Fbh1 UTSW 2 11,748,441 (GRCm39) missense probably benign 0.01
R8517:Fbh1 UTSW 2 11,782,241 (GRCm39) critical splice donor site probably null
R8686:Fbh1 UTSW 2 11,760,469 (GRCm39) missense probably benign 0.00
R8883:Fbh1 UTSW 2 11,753,922 (GRCm39) missense probably benign 0.21
R9093:Fbh1 UTSW 2 11,764,801 (GRCm39) missense probably damaging 1.00
R9306:Fbh1 UTSW 2 11,772,387 (GRCm39) missense probably benign 0.00
R9342:Fbh1 UTSW 2 11,754,414 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGCGGGTCATTGATTATTTC -3'
(R):5'- TCATCAGGATCTGCACAGCC -3'

Sequencing Primer
(F):5'- GGTCATTGATTATTTCCCTCCACAGG -3'
(R):5'- GGCTCACTGCTTTGAGGAAG -3'
Posted On 2020-01-23