Incidental Mutation 'R8000:Fbxo18'
ID616303
Institutional Source Beutler Lab
Gene Symbol Fbxo18
Ensembl Gene ENSMUSG00000058594
Gene NameF-box protein 18
SynonymsFbx18
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R8000 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location11742573-11777582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11767289 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 194 (Y194N)
Ref Sequence ENSEMBL: ENSMUSP00000071495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071564]
Predicted Effect probably benign
Transcript: ENSMUST00000071564
AA Change: Y194N

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594
AA Change: Y194N

DomainStartEndE-ValueType
FBOX 213 256 3.94e-3 SMART
Pfam:UvrD-helicase 626 692 8e-10 PFAM
Pfam:UvrD_C 862 935 1.7e-12 PFAM
Pfam:UvrD_C_2 867 931 1.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029I15Rik A G 2: 92,385,527 K69E unknown Het
4833423E24Rik A G 2: 85,518,726 V14A probably benign Het
Aadacl2 A G 3: 60,017,375 K121R possibly damaging Het
Acaca A G 11: 84,392,231 K2208E possibly damaging Het
Actn1 A G 12: 80,199,008 F134L probably damaging Het
Akt3 A T 1: 177,050,197 V335D probably damaging Het
Arhgef10 T G 8: 14,930,054 I98S probably damaging Het
Celf4 T C 18: 25,504,517 N209S probably benign Het
Col4a4 G A 1: 82,541,297 P59L unknown Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
Dock4 T A 12: 40,833,119 L1642I probably benign Het
Fam213a A C 14: 40,994,526 *230G probably null Het
Fap A G 2: 62,502,798 probably null Het
Fras1 A G 5: 96,762,677 T3322A probably damaging Het
Gabra4 A G 5: 71,623,961 F369S probably damaging Het
Igkv9-124 T A 6: 67,942,152 D92V probably damaging Het
Kcna6 C A 6: 126,738,985 E314* probably null Het
Kyat1 A C 2: 30,192,053 S25A probably benign Het
Lars2 G A 9: 123,436,244 G455D probably damaging Het
Mertk A G 2: 128,771,498 H478R probably benign Het
Mier1 A T 4: 103,131,043 T83S probably damaging Het
Mmp1a C A 9: 7,476,214 H437Q probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Neb G T 2: 52,288,844 A1300D probably damaging Het
Nell2 T A 15: 95,435,274 L167F probably damaging Het
Olfr1426 T C 19: 12,087,994 D266G probably damaging Het
Olfr239 G C 17: 33,199,347 A100P probably damaging Het
Olfr527 T A 7: 140,336,342 M160K possibly damaging Het
Pald1 T C 10: 61,347,439 T339A probably benign Het
Pex13 A C 11: 23,655,915 L105W probably damaging Het
Ptprd A C 4: 76,066,242 F556V possibly damaging Het
Rgp1 T A 4: 43,581,664 C314S probably benign Het
Rnaseh2a G A 8: 84,966,049 probably benign Het
Rpl7 A T 1: 16,102,725 M154K probably benign Het
Samd9l A T 6: 3,373,034 L1409Q probably damaging Het
Slc35f3 A G 8: 126,321,073 T51A probably benign Het
Slc7a10 A G 7: 35,200,440 Y76C Het
Slk G T 19: 47,608,905 A51S Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Stk38 A T 17: 28,992,448 V51E probably benign Het
Tecta A T 9: 42,367,184 C1009* probably null Het
Vmn1r228 A T 17: 20,776,965 M97K possibly damaging Het
Xpo4 T C 14: 57,589,946 D931G probably damaging Het
Zfp503 T C 14: 21,986,159 T230A possibly damaging Het
Other mutations in Fbxo18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Fbxo18 APN 2 11757523 nonsense probably null
IGL02081:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02082:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02084:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02086:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02369:Fbxo18 APN 2 11747158 missense possibly damaging 0.61
IGL02584:Fbxo18 APN 2 11759958 missense probably benign 0.07
IGL03138:Fbxo18 UTSW 2 11749509 intron probably benign
R0384:Fbxo18 UTSW 2 11749578 missense probably damaging 1.00
R0479:Fbxo18 UTSW 2 11758419 missense probably damaging 1.00
R0972:Fbxo18 UTSW 2 11764088 splice site probably benign
R1420:Fbxo18 UTSW 2 11767682 missense probably benign 0.01
R1827:Fbxo18 UTSW 2 11763888 missense possibly damaging 0.88
R1832:Fbxo18 UTSW 2 11767400 missense probably benign 0.08
R1960:Fbxo18 UTSW 2 11757528 missense probably damaging 0.98
R2040:Fbxo18 UTSW 2 11769895 missense possibly damaging 0.66
R2044:Fbxo18 UTSW 2 11762970 missense possibly damaging 0.89
R2102:Fbxo18 UTSW 2 11758289 missense probably benign 0.18
R3236:Fbxo18 UTSW 2 11769826 missense probably damaging 1.00
R3975:Fbxo18 UTSW 2 11767210 missense possibly damaging 0.72
R4504:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4505:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4507:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4799:Fbxo18 UTSW 2 11755747 missense probably damaging 1.00
R4894:Fbxo18 UTSW 2 11762960 missense probably damaging 1.00
R4994:Fbxo18 UTSW 2 11764230 missense probably damaging 1.00
R5579:Fbxo18 UTSW 2 11748993 missense probably damaging 0.97
R5801:Fbxo18 UTSW 2 11769826 missense probably damaging 1.00
R6255:Fbxo18 UTSW 2 11748446 missense probably benign 0.31
R7011:Fbxo18 UTSW 2 11762963 missense probably damaging 1.00
R7177:Fbxo18 UTSW 2 11755711 missense probably damaging 1.00
R7243:Fbxo18 UTSW 2 11751525 missense probably benign 0.11
R7331:Fbxo18 UTSW 2 11763986 missense probably benign
R7361:Fbxo18 UTSW 2 11747076 missense probably damaging 1.00
R7460:Fbxo18 UTSW 2 11756685 missense probably benign 0.38
R7541:Fbxo18 UTSW 2 11749537 missense probably benign 0.05
R8010:Fbxo18 UTSW 2 11767632 missense probably benign 0.15
R8056:Fbxo18 UTSW 2 11743630 missense probably benign 0.01
R8517:Fbxo18 UTSW 2 11777430 critical splice donor site probably null
R8686:Fbxo18 UTSW 2 11755658 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGCGGGTCATTGATTATTTC -3'
(R):5'- TCATCAGGATCTGCACAGCC -3'

Sequencing Primer
(F):5'- GGTCATTGATTATTTCCCTCCACAGG -3'
(R):5'- GGCTCACTGCTTTGAGGAAG -3'
Posted On2020-01-23