Mutagenetix > Incidental Mutation

Incidental Mutation 'R8000:Fap'

616306

Institutional Source

Beutler Lab

Gene Symbol

Fap

Ensembl Gene

ENSMUSG00000000392

Gene Name

fibroblast activation protein

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8000 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

62500943-62574075 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 62502798 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099793 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000402] [ENSMUST00000102732] [ENSMUST00000128139] [ENSMUST00000174234] [ENSMUST00000174448]

AlphaFold

P97321

Predicted Effect

probably benign
Transcript: ENSMUST00000000402

SMART Domains

Protein: ENSMUSP00000000402
Gene: ENSMUSG00000000392

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
Pfam:DPPIV_N	73	440	2e-110	PFAM
Pfam:Abhydrolase_5	504	719	2.4e-12	PFAM
Pfam:Abhydrolase_6	515	703	2.3e-10	PFAM
Pfam:Peptidase_S9	520	727	9.4e-60	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000102732

SMART Domains

Protein: ENSMUSP00000099793
Gene: ENSMUSG00000000392

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	106	473	1.9e-106	PFAM
Pfam:Abhydrolase_5	537	752	2.9e-12	PFAM
Pfam:Peptidase_S9	553	760	1.5e-61	PFAM

Predicted Effect

silent
Transcript: ENSMUST00000128139

Predicted Effect

probably benign
Transcript: ENSMUST00000174234

SMART Domains

Protein: ENSMUSP00000133792
Gene: ENSMUSG00000000392

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	82	448	4.1e-108	PFAM
Pfam:Abhydrolase_5	512	727	6.4e-12	PFAM
Pfam:Abhydrolase_6	523	711	8.9e-10	PFAM
Pfam:Peptidase_S9	528	735	5.9e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174448

SMART Domains

Protein: ENSMUSP00000134386
Gene: ENSMUSG00000000392

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:DPPIV_N	101	468	2.2e-110	PFAM
Pfam:Abhydrolase_5	532	747	2.5e-12	PFAM
Pfam:Abhydrolase_6	541	731	2.4e-10	PFAM
Pfam:Peptidase_S9	548	755	1e-59	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene belongs to the serine protease family. The encoded protein is an inducible cell-surface bound glycoprotein specifically expressed in tumor-associated fibroblasts and pericytes of epithelial tumors and has protease and gelatinase activity. The protein plays a role in remodeling of the extracellular matrix (ECM) and may affect tumorigenesis and tissue repair. Alternately spliced transcript variants of this gene are described in the literature (PMID 9139873), but the full-length sequence of these variants is not available. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a targeted null mutations exhibit no discernable phenotype; mice are viable and fertile with no change in cancer susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029I15Rik	A	G	2: 92,385,527	K69E	unknown	Het
4833423E24Rik	A	G	2: 85,518,726	V14A	probably benign	Het
Aadacl2	A	G	3: 60,017,375	K121R	possibly damaging	Het
Acaca	A	G	11: 84,392,231	K2208E	possibly damaging	Het
Actn1	A	G	12: 80,199,008	F134L	probably damaging	Het
Akt3	A	T	1: 177,050,197	V335D	probably damaging	Het
Arhgef10	T	G	8: 14,930,054	I98S	probably damaging	Het
Celf4	T	C	18: 25,504,517	N209S	probably benign	Het
Col4a4	G	A	1: 82,541,297	P59L	unknown	Het
Dmwd	C	T	7: 19,080,735	L437F	probably damaging	Het
Dock4	T	A	12: 40,833,119	L1642I	probably benign	Het
Fam213a	A	C	14: 40,994,526	*230G	probably null	Het
Fbxo18	A	T	2: 11,767,289	Y194N	probably benign	Het
Fras1	A	G	5: 96,762,677	T3322A	probably damaging	Het
Gabra4	A	G	5: 71,623,961	F369S	probably damaging	Het
Igkv9-124	T	A	6: 67,942,152	D92V	probably damaging	Het
Kcna6	C	A	6: 126,738,985	E314*	probably null	Het
Kyat1	A	C	2: 30,192,053	S25A	probably benign	Het
Lars2	G	A	9: 123,436,244	G455D	probably damaging	Het
Mertk	A	G	2: 128,771,498	H478R	probably benign	Het
Mier1	A	T	4: 103,131,043	T83S	probably damaging	Het
Mmp1a	C	A	9: 7,476,214	H437Q	probably benign	Het
Muc4	C	G	16: 32,753,930	Q1269E	probably benign	Het
Neb	G	T	2: 52,288,844	A1300D	probably damaging	Het
Nell2	T	A	15: 95,435,274	L167F	probably damaging	Het
Olfr1426	T	C	19: 12,087,994	D266G	probably damaging	Het
Olfr239	G	C	17: 33,199,347	A100P	probably damaging	Het
Olfr527	T	A	7: 140,336,342	M160K	possibly damaging	Het
Pald1	T	C	10: 61,347,439	T339A	probably benign	Het
Pex13	A	C	11: 23,655,915	L105W	probably damaging	Het
Ptprd	A	C	4: 76,066,242	F556V	possibly damaging	Het
Rgp1	T	A	4: 43,581,664	C314S	probably benign	Het
Rnaseh2a	G	A	8: 84,966,049		probably benign	Het
Rpl7	A	T	1: 16,102,725	M154K	probably benign	Het
Samd9l	A	T	6: 3,373,034	L1409Q	probably damaging	Het
Slc35f3	A	G	8: 126,321,073	T51A	probably benign	Het
Slc7a10	A	G	7: 35,200,440	Y76C		Het
Slk	G	T	19: 47,608,905	A51S		Het
Son	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	16: 91,660,334		probably benign	Het
Stk38	A	T	17: 28,992,448	V51E	probably benign	Het
Tecta	A	T	9: 42,367,184	C1009*	probably null	Het
Vmn1r228	A	T	17: 20,776,965	M97K	possibly damaging	Het
Xpo4	T	C	14: 57,589,946	D931G	probably damaging	Het
Zfp503	T	C	14: 21,986,159	T230A	possibly damaging	Het

Other mutations in Fap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Fap	APN	2	62524201	missense	possibly damaging	0.82
IGL01420:Fap	APN	2	62504502	splice site	probably benign
IGL01485:Fap	APN	2	62544311	missense	possibly damaging	0.80
IGL01987:Fap	APN	2	62528676	missense	probably damaging	1.00
IGL02198:Fap	APN	2	62554798	missense	probably benign
IGL02355:Fap	APN	2	62573498	missense	probably benign	0.02
IGL02362:Fap	APN	2	62573498	missense	probably benign	0.02
IGL03227:Fap	APN	2	62530763	critical splice acceptor site	probably null
IGL03266:Fap	APN	2	62537022	missense	probably benign
IGL03369:Fap	APN	2	62503355	splice site	probably benign
IGL03406:Fap	APN	2	62542122	splice site	probably benign
mnemosyne	UTSW	2	62528714	missense	probably damaging	1.00
R1467_Fap_571	UTSW	2	62517620	missense	probably benign	0.18
R4812_Fap_496	UTSW	2	62519021	missense	probably damaging	1.00
R5661_fap_070	UTSW	2	62536963	intron	probably benign
ANU74:Fap	UTSW	2	62547769	missense	probably damaging	1.00
R0254:Fap	UTSW	2	62503402	missense	probably damaging	1.00
R0842:Fap	UTSW	2	62537001	missense	probably damaging	1.00
R1467:Fap	UTSW	2	62517620	missense	probably benign	0.18
R1467:Fap	UTSW	2	62517620	missense	probably benign	0.18
R1591:Fap	UTSW	2	62553857	missense	probably damaging	0.99
R1671:Fap	UTSW	2	62553835	missense	possibly damaging	0.46
R1674:Fap	UTSW	2	62519005	missense	probably benign
R1795:Fap	UTSW	2	62548589	missense	probably damaging	1.00
R1869:Fap	UTSW	2	62528727	missense	probably damaging	1.00
R2032:Fap	UTSW	2	62542237	missense	probably benign	0.43
R2136:Fap	UTSW	2	62524207	missense	possibly damaging	0.94
R3546:Fap	UTSW	2	62519011	missense	probably damaging	1.00
R3547:Fap	UTSW	2	62519011	missense	probably damaging	1.00
R3771:Fap	UTSW	2	62533010	missense	probably damaging	1.00
R3801:Fap	UTSW	2	62546650	missense	probably benign	0.04
R3910:Fap	UTSW	2	62556104	missense	probably damaging	1.00
R4306:Fap	UTSW	2	62530707	critical splice donor site	probably null
R4323:Fap	UTSW	2	62503372	missense	probably damaging	0.97
R4517:Fap	UTSW	2	62530715	missense	probably benign	0.01
R4793:Fap	UTSW	2	62544369	missense	probably damaging	1.00
R4812:Fap	UTSW	2	62519021	missense	probably damaging	1.00
R4843:Fap	UTSW	2	62544374	missense	probably damaging	1.00
R5281:Fap	UTSW	2	62532961	critical splice donor site	probably null
R5661:Fap	UTSW	2	62536963	intron	probably benign
R5696:Fap	UTSW	2	62502459	missense	probably damaging	1.00
R5750:Fap	UTSW	2	62528714	missense	probably damaging	1.00
R5898:Fap	UTSW	2	62573503	missense	probably benign
R5907:Fap	UTSW	2	62544356	missense	probably damaging	1.00
R5944:Fap	UTSW	2	62542261	missense	probably damaging	1.00
R5991:Fap	UTSW	2	62518521	missense	probably damaging	1.00
R6110:Fap	UTSW	2	62554770	missense	possibly damaging	0.91
R6270:Fap	UTSW	2	62547788	missense	probably damaging	0.98
R6505:Fap	UTSW	2	62546603	nonsense	probably null
R6631:Fap	UTSW	2	62503381	missense	probably damaging	1.00
R6896:Fap	UTSW	2	62504600	nonsense	probably null
R7138:Fap	UTSW	2	62542178	missense	probably benign	0.10
R7806:Fap	UTSW	2	62503414	missense	probably damaging	1.00
R8115:Fap	UTSW	2	62519041	missense	probably benign	0.07
R8737:Fap	UTSW	2	62512433	missense	probably benign	0.00
R8899:Fap	UTSW	2	62518473	missense	probably damaging	1.00
R8924:Fap	UTSW	2	62547821	missense	probably benign
R8972:Fap	UTSW	2	62548583	missense	probably benign	0.02
R8998:Fap	UTSW	2	62537024	missense	probably benign	0.12
R8999:Fap	UTSW	2	62537024	missense	probably benign	0.12
R9418:Fap	UTSW	2	62554837	nonsense	probably null
R9521:Fap	UTSW	2	62542156	missense	probably benign
R9686:Fap	UTSW	2	62573513	missense	possibly damaging	0.86
X0017:Fap	UTSW	2	62556180	missense	probably benign	0.04
X0026:Fap	UTSW	2	62512390	missense	probably damaging	1.00
Z1176:Fap	UTSW	2	62528774	missense	possibly damaging	0.87
Z1177:Fap	UTSW	2	62502446	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAAATACCAGAGAGCCTAGAGTGAC -3'
(R):5'- TTTCAGTATTGGTGCGAAGTCC -3'

Sequencing Primer
(F):5'- CTAGAGTGACAATGCACTGCCTG -3'
(R):5'- TGCGAAGTCCATTGCACAATG -3'

Posted On

2020-01-23