Incidental Mutation 'R0675:Chd1'
ID61633
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Namechromodomain helicase DNA binding protein 1
Synonyms4930525N21Rik
MMRRC Submission 038860-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0675 (G1)
Quality Score86
Status Validated
Chromosome17
Chromosomal Location15704967-15772610 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 15758261 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627]
Predicted Effect probably benign
Transcript: ENSMUST00000024627
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173040
SMART Domains Protein: ENSMUSP00000133406
Gene: ENSMUSG00000023852

DomainStartEndE-ValueType
Blast:DEXDc 2 102 5e-58 BLAST
PDB:4B4C|A 2 153 1e-108 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174461
SMART Domains Protein: ENSMUSP00000134718
Gene: ENSMUSG00000023852

DomainStartEndE-ValueType
Pfam:SNF2_N 1 148 3.6e-34 PFAM
low complexity region 172 184 N/A INTRINSIC
HELICc 201 285 8.48e-25 SMART
Blast:DEXDc 340 516 1e-47 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (88/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,776 E140G probably benign Het
4932431P20Rik T C 7: 29,532,517 noncoding transcript Het
Ablim2 C T 5: 35,866,780 probably benign Het
Aire T C 10: 78,034,493 probably benign Het
Akap12 T C 10: 4,353,315 S42P probably benign Het
Amigo1 T C 3: 108,191,669 probably benign Het
Angptl3 A G 4: 99,033,262 T206A probably benign Het
Ank1 T A 8: 23,110,384 probably benign Het
Ano5 A T 7: 51,574,810 T472S probably damaging Het
Arid3c T C 4: 41,725,958 D215G probably damaging Het
Cd200 T C 16: 45,397,110 I73V probably benign Het
Cd47 T C 16: 49,906,799 I318T possibly damaging Het
Cep290 A G 10: 100,568,813 probably null Het
Cep350 A G 1: 155,959,753 S66P possibly damaging Het
Cfap46 C T 7: 139,676,034 C300Y probably damaging Het
Chd5 C A 4: 152,385,950 T1913K probably benign Het
Clec4b1 A G 6: 123,071,446 Y180C probably damaging Het
Cntnap5c A T 17: 58,034,995 D227V probably damaging Het
Col19a1 C G 1: 24,575,455 probably benign Het
Csmd1 A T 8: 16,158,131 M1270K probably benign Het
Cyp2c66 T A 19: 39,186,616 F487I possibly damaging Het
Dpp8 T C 9: 65,066,502 probably benign Het
Duoxa1 A T 2: 122,306,380 probably benign Het
Edil3 A G 13: 89,177,280 K263E probably damaging Het
Fat2 A G 11: 55,309,209 L1013P probably damaging Het
Fras1 T C 5: 96,667,387 probably benign Het
Gab1 A G 8: 80,769,668 S668P probably damaging Het
Galnt14 T C 17: 73,545,035 T130A probably damaging Het
Gm10192 G A 4: 97,182,872 H99Y unknown Het
Gm5592 A G 7: 41,289,387 T698A possibly damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Gsdma3 A G 11: 98,631,191 K149R probably benign Het
Igkv4-71 A G 6: 69,243,427 S29P probably damaging Het
Igsf10 C T 3: 59,328,594 V1389I probably benign Het
Ik T C 18: 36,747,333 probably benign Het
Ino80 G A 2: 119,383,481 P1203S probably damaging Het
Iqsec2 G A X: 152,204,124 E398K possibly damaging Het
Jmjd6 A G 11: 116,840,527 V232A probably damaging Het
Klhdc9 G A 1: 171,360,327 T112M possibly damaging Het
Marcks A G 10: 37,141,185 probably benign Het
Mctp2 T A 7: 72,083,170 T829S probably damaging Het
Mroh2a C A 1: 88,228,380 A78E probably damaging Het
Mroh2a G A 1: 88,250,342 D1053N probably damaging Het
Mtmr14 A T 6: 113,270,647 H518L probably damaging Het
Mum1 T A 10: 80,230,080 V56E probably damaging Het
Myo5c T C 9: 75,278,289 M978T probably benign Het
Nlrc3 T C 16: 3,948,911 I1015V probably benign Het
Nlrp5 C A 7: 23,417,417 Q189K possibly damaging Het
Olfr1082 T C 2: 86,594,079 I250V probably benign Het
Olfr385 A C 11: 73,589,252 L162R probably damaging Het
Olfr583 A G 7: 103,051,702 I135V probably benign Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Otof T A 5: 30,382,361 Y1051F probably benign Het
Pcdhb14 C A 18: 37,448,339 T166K possibly damaging Het
Pla2g4e A G 2: 120,200,198 probably benign Het
Polr3gl T C 3: 96,582,155 E20G probably damaging Het
Psmd1 A G 1: 86,082,039 D295G probably benign Het
Ptpn21 C A 12: 98,688,216 A831S probably benign Het
Rd3l T C 12: 111,980,162 D60G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,441,834 D2624G probably benign Het
Sec31a T C 5: 100,393,207 D347G probably damaging Het
Sema4g G A 19: 44,997,587 R289H probably damaging Het
Sema5b C T 16: 35,660,333 T761I probably benign Het
Sept1 A T 7: 127,216,999 F86L probably damaging Het
Shank3 T C 15: 89,531,388 V627A possibly damaging Het
Slc25a46 C A 18: 31,609,588 G75V probably benign Het
Slc45a2 T A 15: 11,025,778 Y405N probably damaging Het
Spidr T C 16: 16,037,634 E339G probably damaging Het
Sptbn1 A T 11: 30,117,903 H1770Q probably damaging Het
Srgap1 T C 10: 121,792,235 Y944C probably damaging Het
Supt20 C T 3: 54,706,969 T169I probably damaging Het
Tie1 G A 4: 118,479,769 Q587* probably null Het
Tmem214 A G 5: 30,871,825 T203A possibly damaging Het
Tmprss15 C A 16: 78,985,950 S742I probably damaging Het
Zfhx2 A G 14: 55,063,163 V2377A probably damaging Het
Zfp763 G A 17: 33,019,800 H124Y possibly damaging Het
Zfp846 T C 9: 20,593,557 S238P probably benign Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15732565 missense probably benign 0.37
IGL01356:Chd1 APN 17 15749865 missense probably damaging 1.00
IGL01369:Chd1 APN 17 15754997 missense probably damaging 0.97
IGL01519:Chd1 APN 17 17378569 missense probably damaging 1.00
IGL01604:Chd1 APN 17 15770097 missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17378596 missense probably damaging 1.00
IGL01721:Chd1 APN 17 15770168 missense probably damaging 1.00
IGL01959:Chd1 APN 17 15742173 missense probably damaging 1.00
IGL02367:Chd1 APN 17 17390053 missense probably damaging 0.98
IGL02476:Chd1 APN 17 15734273 missense probably damaging 1.00
IGL02756:Chd1 APN 17 15730807 missense probably damaging 0.97
IGL02817:Chd1 APN 17 15749500 missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15770298 missense probably benign 0.22
IGL03108:Chd1 APN 17 15725281 missense possibly damaging 0.70
Holly UTSW 17 15726283 missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0128:Chd1 UTSW 17 17393567 missense probably damaging 1.00
R0197:Chd1 UTSW 17 15725431 missense probably benign
R0285:Chd1 UTSW 17 17374680 splice site probably benign
R0326:Chd1 UTSW 17 15768566 missense probably damaging 1.00
R0326:Chd1 UTSW 17 15768568 missense probably benign
R0372:Chd1 UTSW 17 17387290 missense probably benign 0.14
R0391:Chd1 UTSW 17 15749894 missense probably damaging 1.00
R0486:Chd1 UTSW 17 15734342 missense probably damaging 0.99
R0637:Chd1 UTSW 17 15742288 missense possibly damaging 0.50
R0701:Chd1 UTSW 17 15725431 missense probably benign
R0788:Chd1 UTSW 17 15707114 missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15770241 missense probably damaging 1.00
R0883:Chd1 UTSW 17 15725431 missense probably benign
R1169:Chd1 UTSW 17 15735732 missense probably damaging 1.00
R1218:Chd1 UTSW 17 15725312 missense probably damaging 1.00
R1370:Chd1 UTSW 17 17387480 missense probably benign 0.00
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15739507 missense probably damaging 0.99
R1752:Chd1 UTSW 17 15743232 critical splice donor site probably null
R1759:Chd1 UTSW 17 17387271 missense probably benign 0.00
R1767:Chd1 UTSW 17 15770303 missense probably damaging 1.00
R1938:Chd1 UTSW 17 15762486 missense probably benign 0.39
R2007:Chd1 UTSW 17 15731006 missense probably damaging 1.00
R2069:Chd1 UTSW 17 15742294 missense probably damaging 1.00
R3771:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3773:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3849:Chd1 UTSW 17 15731871 missense probably damaging 1.00
R4241:Chd1 UTSW 17 15770027 nonsense probably null
R4242:Chd1 UTSW 17 15770027 nonsense probably null
R4354:Chd1 UTSW 17 17390001 missense probably benign 0.23
R4468:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4469:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4731:Chd1 UTSW 17 17377817 missense probably benign 0.36
R4824:Chd1 UTSW 17 15733124 missense probably damaging 1.00
R4840:Chd1 UTSW 17 15768753 nonsense probably null
R4840:Chd1 UTSW 17 15768754 missense probably damaging 1.00
R4880:Chd1 UTSW 17 17374654 missense probably damaging 1.00
R4960:Chd1 UTSW 17 15742231 missense probably damaging 0.96
R5071:Chd1 UTSW 17 15762405 missense probably benign
R5078:Chd1 UTSW 17 15726354 missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15728198 missense probably benign 0.25
R5268:Chd1 UTSW 17 15735743 missense probably damaging 1.00
R5304:Chd1 UTSW 17 15754951 missense probably benign 0.01
R5304:Chd1 UTSW 17 15770268 missense possibly damaging 0.55
R5307:Chd1 UTSW 17 15732570 missense probably damaging 1.00
R5458:Chd1 UTSW 17 15738549 missense probably damaging 1.00
R5553:Chd1 UTSW 17 17385613 missense probably benign 0.17
R5623:Chd1 UTSW 17 15754932 missense probably damaging 1.00
R6022:Chd1 UTSW 17 17377773 missense probably benign 0.39
R6137:Chd1 UTSW 17 15758688 missense probably damaging 1.00
R6257:Chd1 UTSW 17 15730203 splice site probably null
R6373:Chd1 UTSW 17 15738636 missense probably damaging 1.00
R6458:Chd1 UTSW 17 15730602 missense probably benign 0.01
R6476:Chd1 UTSW 17 17380988 critical splice donor site probably null
R6508:Chd1 UTSW 17 15738633 missense probably benign 0.31
R6553:Chd1 UTSW 17 15725430 missense probably benign 0.00
R6745:Chd1 UTSW 17 17387167 missense probably benign 0.08
R7107:Chd1 UTSW 17 15761366 missense probably damaging 0.98
R7230:Chd1 UTSW 17 15706937 splice site probably null
R7317:Chd1 UTSW 17 15742274 missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15770237 missense probably damaging 0.99
R7421:Chd1 UTSW 17 15749398 missense probably benign 0.03
R7704:Chd1 UTSW 17 15767475 missense probably benign
R7763:Chd1 UTSW 17 15733041 missense probably damaging 1.00
R8156:Chd1 UTSW 17 15761404 missense probably benign
R8194:Chd1 UTSW 17 17374475 start gained probably benign
R8261:Chd1 UTSW 17 17387542 missense probably benign 0.02
R8338:Chd1 UTSW 17 15769980 missense probably damaging 1.00
R8401:Chd1 UTSW 17 15743211 missense probably damaging 1.00
R8411:Chd1 UTSW 17 15762449 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15766347 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15768733 missense probably damaging 1.00
Z1177:Chd1 UTSW 17 15747801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGGACCTGCCTGGATGGATAG -3'
(R):5'- TGCACATGTTCAGAAGAGAGCCCC -3'

Sequencing Primer
(F):5'- CTGAAGAAATCACTGTGAAGTTCCC -3'
(R):5'- AGAGAGCCCCACCCTGTC -3'
Posted On2013-07-30