Incidental Mutation 'R8000:Acaca'
ID 616330
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Name acetyl-Coenzyme A carboxylase alpha
Synonyms Acc1, LOC327983, Acac, acetyl-CoA carboxylase, A530025K05Rik
MMRRC Submission 046040-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8000 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84020498-84292477 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84283057 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 2208 (K2208E)
Ref Sequence ENSEMBL: ENSMUSP00000020843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201]
AlphaFold Q5SWU9
Predicted Effect possibly damaging
Transcript: ENSMUST00000020843
AA Change: K2208E

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: K2208E

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103201
AA Change: K2208E

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: K2208E

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A G 3: 59,924,796 (GRCm39) K121R possibly damaging Het
Actn1 A G 12: 80,245,782 (GRCm39) F134L probably damaging Het
Akt3 A T 1: 176,877,763 (GRCm39) V335D probably damaging Het
Arhgef10 T G 8: 14,980,054 (GRCm39) I98S probably damaging Het
Celf4 T C 18: 25,637,574 (GRCm39) N209S probably benign Het
Col4a4 G A 1: 82,519,018 (GRCm39) P59L unknown Het
Dmwd C T 7: 18,814,660 (GRCm39) L437F probably damaging Het
Dock4 T A 12: 40,883,118 (GRCm39) L1642I probably benign Het
Fads2b A G 2: 85,349,070 (GRCm39) V14A probably benign Het
Fap A G 2: 62,333,142 (GRCm39) probably null Het
Fbh1 A T 2: 11,772,100 (GRCm39) Y194N probably benign Het
Fras1 A G 5: 96,910,536 (GRCm39) T3322A probably damaging Het
Frey1 A G 2: 92,215,872 (GRCm39) K69E unknown Het
Gabra4 A G 5: 71,781,304 (GRCm39) F369S probably damaging Het
Igkv9-124 T A 6: 67,919,136 (GRCm39) D92V probably damaging Het
Kcna6 C A 6: 126,715,948 (GRCm39) E314* probably null Het
Kyat1 A C 2: 30,082,065 (GRCm39) S25A probably benign Het
Lars2 G A 9: 123,265,309 (GRCm39) G455D probably damaging Het
Mertk A G 2: 128,613,418 (GRCm39) H478R probably benign Het
Mier1 A T 4: 102,988,240 (GRCm39) T83S probably damaging Het
Mmp1a C A 9: 7,476,215 (GRCm39) H437Q probably benign Het
Muc4 C G 16: 32,575,221 (GRCm39) Q1269E probably benign Het
Neb G T 2: 52,178,856 (GRCm39) A1300D probably damaging Het
Nell2 T A 15: 95,333,155 (GRCm39) L167F probably damaging Het
Or10h1 G C 17: 33,418,321 (GRCm39) A100P probably damaging Het
Or12j2 T A 7: 139,916,255 (GRCm39) M160K possibly damaging Het
Or4d10c T C 19: 12,065,358 (GRCm39) D266G probably damaging Het
Pald1 T C 10: 61,183,218 (GRCm39) T339A probably benign Het
Pex13 A C 11: 23,605,915 (GRCm39) L105W probably damaging Het
Prxl2a A C 14: 40,716,483 (GRCm39) *230G probably null Het
Ptprd A C 4: 75,984,479 (GRCm39) F556V possibly damaging Het
Rgp1 T A 4: 43,581,664 (GRCm39) C314S probably benign Het
Rnaseh2a G A 8: 85,692,678 (GRCm39) probably benign Het
Rpl7 A T 1: 16,172,949 (GRCm39) M154K probably benign Het
Samd9l A T 6: 3,373,034 (GRCm39) L1409Q probably damaging Het
Slc35f3 A G 8: 127,047,812 (GRCm39) T51A probably benign Het
Slc7a10 A G 7: 34,899,865 (GRCm39) Y76C Het
Slk G T 19: 47,597,344 (GRCm39) A51S Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,222 (GRCm39) probably benign Het
Stk38 A T 17: 29,211,422 (GRCm39) V51E probably benign Het
Tecta A T 9: 42,278,480 (GRCm39) C1009* probably null Het
Vmn1r228 A T 17: 20,997,227 (GRCm39) M97K possibly damaging Het
Xpo4 T C 14: 57,827,403 (GRCm39) D931G probably damaging Het
Zfp503 T C 14: 22,036,227 (GRCm39) T230A possibly damaging Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84,169,743 (GRCm39) missense probably damaging 1.00
IGL01134:Acaca APN 11 84,142,105 (GRCm39) missense probably benign 0.22
IGL01446:Acaca APN 11 84,151,457 (GRCm39) missense probably damaging 1.00
IGL01591:Acaca APN 11 84,134,146 (GRCm39) missense probably damaging 1.00
IGL01663:Acaca APN 11 84,168,628 (GRCm39) missense possibly damaging 0.85
IGL01767:Acaca APN 11 84,211,368 (GRCm39) missense probably benign 0.01
IGL02206:Acaca APN 11 84,151,573 (GRCm39) nonsense probably null
IGL02335:Acaca APN 11 84,105,084 (GRCm39) missense possibly damaging 0.84
IGL02477:Acaca APN 11 84,197,994 (GRCm39) splice site probably benign
IGL02515:Acaca APN 11 84,153,229 (GRCm39) missense probably benign
IGL02651:Acaca APN 11 84,136,030 (GRCm39) splice site probably benign
IGL02805:Acaca APN 11 84,113,959 (GRCm39) splice site probably benign
IGL03328:Acaca APN 11 84,211,355 (GRCm39) missense probably benign 0.00
effervescence UTSW 11 84,153,300 (GRCm39) missense probably benign 0.41
fizz UTSW 11 84,136,682 (GRCm39) missense probably damaging 0.98
greenhouse UTSW 11 84,229,182 (GRCm39) missense probably damaging 1.00
Serene UTSW 11 84,202,235 (GRCm39) splice site probably null
Tranquil UTSW 11 84,171,287 (GRCm39) missense probably damaging 1.00
vitamin UTSW 11 84,171,261 (GRCm39) missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84,206,678 (GRCm39) missense probably damaging 1.00
R0385:Acaca UTSW 11 84,122,574 (GRCm39) missense probably benign 0.01
R0518:Acaca UTSW 11 84,181,112 (GRCm39) critical splice acceptor site probably null
R0536:Acaca UTSW 11 84,171,342 (GRCm39) splice site probably benign
R0962:Acaca UTSW 11 84,202,129 (GRCm39) missense probably damaging 1.00
R0968:Acaca UTSW 11 84,129,859 (GRCm39) nonsense probably null
R1123:Acaca UTSW 11 84,154,906 (GRCm39) missense probably benign 0.09
R1452:Acaca UTSW 11 84,185,885 (GRCm39) splice site probably benign
R1478:Acaca UTSW 11 84,263,453 (GRCm39) missense probably damaging 1.00
R1500:Acaca UTSW 11 84,184,810 (GRCm39) missense probably benign 0.00
R1512:Acaca UTSW 11 84,086,295 (GRCm39) missense probably benign 0.00
R1657:Acaca UTSW 11 84,154,910 (GRCm39) missense probably benign 0.09
R1681:Acaca UTSW 11 84,117,011 (GRCm39) missense probably damaging 1.00
R1682:Acaca UTSW 11 84,283,043 (GRCm39) missense probably benign 0.23
R1688:Acaca UTSW 11 84,129,722 (GRCm39) missense probably damaging 1.00
R1755:Acaca UTSW 11 84,167,390 (GRCm39) frame shift probably null
R1775:Acaca UTSW 11 84,191,248 (GRCm39) missense possibly damaging 0.56
R1793:Acaca UTSW 11 84,229,219 (GRCm39) missense probably damaging 1.00
R1793:Acaca UTSW 11 84,206,795 (GRCm39) missense probably damaging 0.98
R1855:Acaca UTSW 11 84,262,380 (GRCm39) missense probably damaging 0.96
R1881:Acaca UTSW 11 84,191,297 (GRCm39) splice site probably benign
R1881:Acaca UTSW 11 84,161,213 (GRCm39) nonsense probably null
R1989:Acaca UTSW 11 84,153,355 (GRCm39) missense probably damaging 0.98
R2147:Acaca UTSW 11 84,167,362 (GRCm39) missense probably benign 0.03
R2215:Acaca UTSW 11 84,254,619 (GRCm39) missense probably damaging 1.00
R2238:Acaca UTSW 11 84,282,331 (GRCm39) splice site probably benign
R2252:Acaca UTSW 11 84,262,358 (GRCm39) missense probably damaging 0.99
R2316:Acaca UTSW 11 84,185,809 (GRCm39) missense possibly damaging 0.69
R2316:Acaca UTSW 11 84,154,906 (GRCm39) missense probably benign 0.16
R2337:Acaca UTSW 11 84,148,023 (GRCm39) missense possibly damaging 0.93
R2697:Acaca UTSW 11 84,255,239 (GRCm39) missense probably damaging 1.00
R3551:Acaca UTSW 11 84,152,450 (GRCm39) missense probably damaging 1.00
R3552:Acaca UTSW 11 84,152,450 (GRCm39) missense probably damaging 1.00
R3748:Acaca UTSW 11 84,202,235 (GRCm39) splice site probably null
R3844:Acaca UTSW 11 84,255,239 (GRCm39) missense probably damaging 1.00
R3873:Acaca UTSW 11 84,203,547 (GRCm39) unclassified probably benign
R4152:Acaca UTSW 11 84,183,752 (GRCm39) missense possibly damaging 0.88
R4406:Acaca UTSW 11 84,171,275 (GRCm39) missense probably benign 0.35
R4448:Acaca UTSW 11 84,153,318 (GRCm39) missense probably damaging 1.00
R4642:Acaca UTSW 11 84,171,287 (GRCm39) missense probably damaging 1.00
R4696:Acaca UTSW 11 84,171,261 (GRCm39) missense possibly damaging 0.78
R4707:Acaca UTSW 11 84,203,680 (GRCm39) missense probably damaging 0.96
R4710:Acaca UTSW 11 84,283,163 (GRCm39) missense possibly damaging 0.84
R4775:Acaca UTSW 11 84,134,165 (GRCm39) missense probably damaging 1.00
R4821:Acaca UTSW 11 84,185,813 (GRCm39) missense possibly damaging 0.69
R4883:Acaca UTSW 11 84,142,116 (GRCm39) missense probably benign 0.01
R4988:Acaca UTSW 11 84,154,121 (GRCm39) missense probably damaging 1.00
R5034:Acaca UTSW 11 84,136,090 (GRCm39) missense probably benign 0.00
R5255:Acaca UTSW 11 84,202,133 (GRCm39) missense probably damaging 1.00
R5294:Acaca UTSW 11 84,282,345 (GRCm39) missense probably benign 0.01
R5350:Acaca UTSW 11 84,106,699 (GRCm39) missense probably damaging 0.99
R5437:Acaca UTSW 11 84,237,646 (GRCm39) splice site probably null
R5664:Acaca UTSW 11 84,134,210 (GRCm39) missense probably damaging 1.00
R5665:Acaca UTSW 11 84,136,120 (GRCm39) nonsense probably null
R5959:Acaca UTSW 11 84,106,792 (GRCm39) missense probably damaging 1.00
R6011:Acaca UTSW 11 84,136,570 (GRCm39) missense probably benign 0.44
R6027:Acaca UTSW 11 84,289,003 (GRCm39) missense probably benign
R6246:Acaca UTSW 11 84,206,796 (GRCm39) missense probably benign 0.08
R6313:Acaca UTSW 11 84,183,755 (GRCm39) missense probably benign 0.00
R6450:Acaca UTSW 11 84,171,294 (GRCm39) missense probably damaging 0.98
R6623:Acaca UTSW 11 84,262,325 (GRCm39) critical splice acceptor site probably null
R6736:Acaca UTSW 11 84,129,664 (GRCm39) missense probably benign 0.05
R6752:Acaca UTSW 11 84,086,309 (GRCm39) missense probably benign 0.44
R6807:Acaca UTSW 11 84,282,356 (GRCm39) missense probably benign
R6826:Acaca UTSW 11 84,086,362 (GRCm39) missense probably damaging 1.00
R7035:Acaca UTSW 11 84,129,769 (GRCm39) missense probably damaging 1.00
R7078:Acaca UTSW 11 84,154,138 (GRCm39) missense possibly damaging 0.91
R7088:Acaca UTSW 11 84,169,783 (GRCm39) critical splice donor site probably null
R7201:Acaca UTSW 11 84,153,300 (GRCm39) missense probably benign 0.41
R7261:Acaca UTSW 11 84,259,526 (GRCm39) missense probably damaging 1.00
R7399:Acaca UTSW 11 84,151,505 (GRCm39) missense possibly damaging 0.89
R7421:Acaca UTSW 11 84,254,562 (GRCm39) missense possibly damaging 0.64
R7443:Acaca UTSW 11 84,206,619 (GRCm39) missense probably benign 0.02
R7453:Acaca UTSW 11 84,136,136 (GRCm39) missense probably benign
R7471:Acaca UTSW 11 84,168,608 (GRCm39) splice site probably null
R7519:Acaca UTSW 11 84,136,682 (GRCm39) missense probably damaging 0.98
R7537:Acaca UTSW 11 84,151,460 (GRCm39) missense probably damaging 1.00
R7574:Acaca UTSW 11 84,152,414 (GRCm39) missense probably benign
R7633:Acaca UTSW 11 84,263,465 (GRCm39) missense probably benign 0.26
R7643:Acaca UTSW 11 84,229,182 (GRCm39) missense probably damaging 1.00
R7664:Acaca UTSW 11 84,136,175 (GRCm39) missense probably damaging 1.00
R7675:Acaca UTSW 11 84,206,742 (GRCm39) missense probably benign 0.04
R7676:Acaca UTSW 11 84,185,813 (GRCm39) missense possibly damaging 0.69
R7729:Acaca UTSW 11 84,262,339 (GRCm39) missense probably damaging 0.98
R7867:Acaca UTSW 11 84,140,350 (GRCm39) missense possibly damaging 0.88
R7898:Acaca UTSW 11 84,255,275 (GRCm39) critical splice donor site probably null
R7909:Acaca UTSW 11 84,136,061 (GRCm39) missense possibly damaging 0.56
R7915:Acaca UTSW 11 84,167,414 (GRCm39) missense probably benign
R7956:Acaca UTSW 11 84,211,406 (GRCm39) missense probably damaging 0.98
R8038:Acaca UTSW 11 84,106,730 (GRCm39) missense probably damaging 1.00
R8545:Acaca UTSW 11 84,236,794 (GRCm39) missense probably damaging 1.00
R8722:Acaca UTSW 11 84,229,283 (GRCm39) missense possibly damaging 0.85
R9005:Acaca UTSW 11 84,262,410 (GRCm39) missense probably damaging 0.99
R9130:Acaca UTSW 11 84,202,145 (GRCm39) missense probably damaging 1.00
R9397:Acaca UTSW 11 84,259,551 (GRCm39) missense probably damaging 1.00
R9489:Acaca UTSW 11 84,183,842 (GRCm39) missense probably benign 0.01
R9540:Acaca UTSW 11 84,134,237 (GRCm39) missense probably damaging 1.00
R9593:Acaca UTSW 11 84,271,339 (GRCm39) nonsense probably null
R9605:Acaca UTSW 11 84,183,842 (GRCm39) missense probably benign 0.01
R9634:Acaca UTSW 11 84,184,816 (GRCm39) missense probably benign 0.00
R9720:Acaca UTSW 11 84,154,183 (GRCm39) missense probably damaging 1.00
RF014:Acaca UTSW 11 84,122,550 (GRCm39) missense probably benign 0.01
X0027:Acaca UTSW 11 84,183,721 (GRCm39) missense probably benign 0.01
X0060:Acaca UTSW 11 84,154,930 (GRCm39) missense probably benign
X0067:Acaca UTSW 11 84,259,563 (GRCm39) nonsense probably null
Z1176:Acaca UTSW 11 84,151,546 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCTTCAAAACCACCGTG -3'
(R):5'- ACAACCCTTGTAACTCTCAGG -3'

Sequencing Primer
(F):5'- CGTGAGGCCTTGGGTAGCAG -3'
(R):5'- TAACTCTCAGGTGCGCTGTACAG -3'
Posted On 2020-01-23