Incidental Mutation 'R8000:Dock4'
ID 616331
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Name dedicator of cytokinesis 4
Synonyms 6330411N01Rik, EST N28122
MMRRC Submission 046040-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.161) question?
Stock # R8000 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 40495956-40896873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40883118 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 1642 (L1642I)
Ref Sequence ENSEMBL: ENSMUSP00000047387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
AlphaFold P59764
Predicted Effect probably benign
Transcript: ENSMUST00000037488
AA Change: L1642I

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: L1642I

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220912
AA Change: L1642I

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A G 3: 59,924,796 (GRCm39) K121R possibly damaging Het
Acaca A G 11: 84,283,057 (GRCm39) K2208E possibly damaging Het
Actn1 A G 12: 80,245,782 (GRCm39) F134L probably damaging Het
Akt3 A T 1: 176,877,763 (GRCm39) V335D probably damaging Het
Arhgef10 T G 8: 14,980,054 (GRCm39) I98S probably damaging Het
Celf4 T C 18: 25,637,574 (GRCm39) N209S probably benign Het
Col4a4 G A 1: 82,519,018 (GRCm39) P59L unknown Het
Dmwd C T 7: 18,814,660 (GRCm39) L437F probably damaging Het
Fads2b A G 2: 85,349,070 (GRCm39) V14A probably benign Het
Fap A G 2: 62,333,142 (GRCm39) probably null Het
Fbh1 A T 2: 11,772,100 (GRCm39) Y194N probably benign Het
Fras1 A G 5: 96,910,536 (GRCm39) T3322A probably damaging Het
Frey1 A G 2: 92,215,872 (GRCm39) K69E unknown Het
Gabra4 A G 5: 71,781,304 (GRCm39) F369S probably damaging Het
Igkv9-124 T A 6: 67,919,136 (GRCm39) D92V probably damaging Het
Kcna6 C A 6: 126,715,948 (GRCm39) E314* probably null Het
Kyat1 A C 2: 30,082,065 (GRCm39) S25A probably benign Het
Lars2 G A 9: 123,265,309 (GRCm39) G455D probably damaging Het
Mertk A G 2: 128,613,418 (GRCm39) H478R probably benign Het
Mier1 A T 4: 102,988,240 (GRCm39) T83S probably damaging Het
Mmp1a C A 9: 7,476,215 (GRCm39) H437Q probably benign Het
Muc4 C G 16: 32,575,221 (GRCm39) Q1269E probably benign Het
Neb G T 2: 52,178,856 (GRCm39) A1300D probably damaging Het
Nell2 T A 15: 95,333,155 (GRCm39) L167F probably damaging Het
Or10h1 G C 17: 33,418,321 (GRCm39) A100P probably damaging Het
Or12j2 T A 7: 139,916,255 (GRCm39) M160K possibly damaging Het
Or4d10c T C 19: 12,065,358 (GRCm39) D266G probably damaging Het
Pald1 T C 10: 61,183,218 (GRCm39) T339A probably benign Het
Pex13 A C 11: 23,605,915 (GRCm39) L105W probably damaging Het
Prxl2a A C 14: 40,716,483 (GRCm39) *230G probably null Het
Ptprd A C 4: 75,984,479 (GRCm39) F556V possibly damaging Het
Rgp1 T A 4: 43,581,664 (GRCm39) C314S probably benign Het
Rnaseh2a G A 8: 85,692,678 (GRCm39) probably benign Het
Rpl7 A T 1: 16,172,949 (GRCm39) M154K probably benign Het
Samd9l A T 6: 3,373,034 (GRCm39) L1409Q probably damaging Het
Slc35f3 A G 8: 127,047,812 (GRCm39) T51A probably benign Het
Slc7a10 A G 7: 34,899,865 (GRCm39) Y76C Het
Slk G T 19: 47,597,344 (GRCm39) A51S Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,222 (GRCm39) probably benign Het
Stk38 A T 17: 29,211,422 (GRCm39) V51E probably benign Het
Tecta A T 9: 42,278,480 (GRCm39) C1009* probably null Het
Vmn1r228 A T 17: 20,997,227 (GRCm39) M97K possibly damaging Het
Xpo4 T C 14: 57,827,403 (GRCm39) D931G probably damaging Het
Zfp503 T C 14: 22,036,227 (GRCm39) T230A possibly damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40,882,305 (GRCm39) missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40,840,067 (GRCm39) splice site probably benign
IGL00790:Dock4 APN 12 40,884,390 (GRCm39) missense probably damaging 1.00
IGL01061:Dock4 APN 12 40,752,968 (GRCm39) missense probably benign 0.01
IGL01083:Dock4 APN 12 40,838,380 (GRCm39) splice site probably benign
IGL01412:Dock4 APN 12 40,780,040 (GRCm39) splice site probably benign
IGL01583:Dock4 APN 12 40,860,466 (GRCm39) nonsense probably null
IGL01603:Dock4 APN 12 40,743,030 (GRCm39) missense probably damaging 1.00
IGL01766:Dock4 APN 12 40,496,378 (GRCm39) nonsense probably null
IGL02067:Dock4 APN 12 40,884,384 (GRCm39) missense probably damaging 1.00
IGL02302:Dock4 APN 12 40,775,776 (GRCm39) missense probably damaging 1.00
IGL02406:Dock4 APN 12 40,827,206 (GRCm39) missense probably benign 0.01
IGL02547:Dock4 APN 12 40,787,478 (GRCm39) missense probably benign
IGL02613:Dock4 APN 12 40,860,465 (GRCm39) missense probably damaging 1.00
IGL02643:Dock4 APN 12 40,718,429 (GRCm39) missense probably damaging 1.00
IGL02952:Dock4 APN 12 40,760,902 (GRCm39) critical splice donor site probably null
IGL02994:Dock4 APN 12 40,829,159 (GRCm39) missense probably damaging 0.99
IGL03096:Dock4 APN 12 40,798,000 (GRCm39) missense probably benign 0.00
IGL03144:Dock4 APN 12 40,742,906 (GRCm39) splice site probably benign
IGL03223:Dock4 APN 12 40,867,593 (GRCm39) missense probably damaging 1.00
IGL03296:Dock4 APN 12 40,783,256 (GRCm39) missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40,783,309 (GRCm39) missense probably benign 0.42
IGL03353:Dock4 APN 12 40,867,757 (GRCm39) splice site probably null
BB005:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
BB015:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0110:Dock4 UTSW 12 40,671,311 (GRCm39) splice site probably benign
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0472:Dock4 UTSW 12 40,888,437 (GRCm39) intron probably benign
R0616:Dock4 UTSW 12 40,754,414 (GRCm39) missense probably benign 0.31
R0647:Dock4 UTSW 12 40,760,883 (GRCm39) missense probably damaging 1.00
R0706:Dock4 UTSW 12 40,752,922 (GRCm39) missense probably damaging 0.98
R0791:Dock4 UTSW 12 40,754,480 (GRCm39) missense probably damaging 1.00
R0940:Dock4 UTSW 12 40,681,626 (GRCm39) splice site probably benign
R1087:Dock4 UTSW 12 40,779,937 (GRCm39) missense probably benign 0.40
R1180:Dock4 UTSW 12 40,690,413 (GRCm39) missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40,879,615 (GRCm39) missense probably damaging 1.00
R1463:Dock4 UTSW 12 40,866,324 (GRCm39) frame shift probably null
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1523:Dock4 UTSW 12 40,743,024 (GRCm39) missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40,719,044 (GRCm39) missense probably damaging 0.99
R1682:Dock4 UTSW 12 40,775,779 (GRCm39) missense probably damaging 1.00
R1691:Dock4 UTSW 12 40,775,754 (GRCm39) missense probably benign 0.26
R1693:Dock4 UTSW 12 40,884,721 (GRCm39) missense probably benign 0.07
R1737:Dock4 UTSW 12 40,857,000 (GRCm39) splice site probably null
R1802:Dock4 UTSW 12 40,844,597 (GRCm39) missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40,686,227 (GRCm39) missense probably damaging 1.00
R1846:Dock4 UTSW 12 40,783,267 (GRCm39) missense probably benign 0.00
R1959:Dock4 UTSW 12 40,760,797 (GRCm39) missense probably damaging 1.00
R1975:Dock4 UTSW 12 40,829,641 (GRCm39) splice site probably benign
R1986:Dock4 UTSW 12 40,780,062 (GRCm39) missense probably damaging 1.00
R2105:Dock4 UTSW 12 40,742,988 (GRCm39) missense probably benign 0.00
R2134:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2135:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2154:Dock4 UTSW 12 40,894,547 (GRCm39) small insertion probably benign
R2154:Dock4 UTSW 12 40,870,661 (GRCm39) missense probably damaging 1.00
R2864:Dock4 UTSW 12 40,780,072 (GRCm39) missense probably damaging 1.00
R2890:Dock4 UTSW 12 40,673,800 (GRCm39) critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40,781,862 (GRCm39) missense probably benign 0.02
R3808:Dock4 UTSW 12 40,722,809 (GRCm39) missense probably damaging 0.99
R3811:Dock4 UTSW 12 40,829,123 (GRCm39) missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R3838:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R4091:Dock4 UTSW 12 40,894,266 (GRCm39) missense probably damaging 0.99
R4735:Dock4 UTSW 12 40,681,525 (GRCm39) missense probably benign 0.31
R4752:Dock4 UTSW 12 40,496,364 (GRCm39) missense probably benign 0.04
R4828:Dock4 UTSW 12 40,718,436 (GRCm39) missense probably damaging 1.00
R5039:Dock4 UTSW 12 40,867,745 (GRCm39) missense probably damaging 1.00
R5092:Dock4 UTSW 12 40,894,440 (GRCm39) missense probably benign
R5146:Dock4 UTSW 12 40,699,491 (GRCm39) splice site probably null
R5213:Dock4 UTSW 12 40,726,741 (GRCm39) missense probably damaging 1.00
R5214:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.00
R5270:Dock4 UTSW 12 40,783,270 (GRCm39) missense probably benign 0.02
R5426:Dock4 UTSW 12 40,795,744 (GRCm39) missense probably damaging 1.00
R5474:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R5544:Dock4 UTSW 12 40,884,701 (GRCm39) missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40,699,479 (GRCm39) missense probably benign 0.22
R5649:Dock4 UTSW 12 40,894,539 (GRCm39) missense probably benign 0.03
R5702:Dock4 UTSW 12 40,787,490 (GRCm39) missense probably benign 0.02
R5846:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R5847:Dock4 UTSW 12 40,671,250 (GRCm39) missense probably damaging 0.97
R5895:Dock4 UTSW 12 40,805,812 (GRCm39) missense probably damaging 1.00
R5997:Dock4 UTSW 12 40,805,833 (GRCm39) missense probably damaging 0.99
R6011:Dock4 UTSW 12 40,867,756 (GRCm39) critical splice donor site probably null
R6022:Dock4 UTSW 12 40,798,109 (GRCm39) missense probably benign 0.04
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6179:Dock4 UTSW 12 40,781,868 (GRCm39) missense probably benign 0.00
R6479:Dock4 UTSW 12 40,878,954 (GRCm39) missense probably damaging 1.00
R6516:Dock4 UTSW 12 40,781,898 (GRCm39) missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.44
R6752:Dock4 UTSW 12 40,870,616 (GRCm39) missense probably damaging 1.00
R6814:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6864:Dock4 UTSW 12 40,795,745 (GRCm39) missense probably damaging 1.00
R6872:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6891:Dock4 UTSW 12 40,829,135 (GRCm39) missense probably damaging 1.00
R6937:Dock4 UTSW 12 40,884,634 (GRCm39) missense probably benign 0.01
R6950:Dock4 UTSW 12 40,783,313 (GRCm39) missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40,671,285 (GRCm39) missense probably damaging 1.00
R7129:Dock4 UTSW 12 40,878,878 (GRCm39) missense probably damaging 1.00
R7140:Dock4 UTSW 12 40,686,158 (GRCm39) missense probably benign 0.06
R7241:Dock4 UTSW 12 40,844,859 (GRCm39) missense probably damaging 1.00
R7378:Dock4 UTSW 12 40,838,243 (GRCm39) missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40,775,648 (GRCm39) nonsense probably null
R7720:Dock4 UTSW 12 40,856,974 (GRCm39) missense probably damaging 0.99
R7756:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7758:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7759:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R7787:Dock4 UTSW 12 40,775,676 (GRCm39) missense probably benign
R7879:Dock4 UTSW 12 40,780,083 (GRCm39) missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R8042:Dock4 UTSW 12 40,795,759 (GRCm39) missense probably benign 0.01
R8231:Dock4 UTSW 12 40,752,950 (GRCm39) missense possibly damaging 0.88
R8234:Dock4 UTSW 12 40,884,837 (GRCm39) splice site probably null
R8758:Dock4 UTSW 12 40,838,231 (GRCm39) missense probably benign 0.12
R8871:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R8873:Dock4 UTSW 12 40,726,767 (GRCm39) nonsense probably null
R8884:Dock4 UTSW 12 40,856,884 (GRCm39) missense probably damaging 1.00
R9164:Dock4 UTSW 12 40,754,337 (GRCm39) missense probably damaging 1.00
R9225:Dock4 UTSW 12 40,879,669 (GRCm39) missense probably benign 0.02
R9276:Dock4 UTSW 12 40,699,404 (GRCm39) missense possibly damaging 0.48
R9307:Dock4 UTSW 12 40,686,155 (GRCm39) missense probably damaging 1.00
R9675:Dock4 UTSW 12 40,894,393 (GRCm39) small insertion probably benign
R9675:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,397 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,401 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,396 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9691:Dock4 UTSW 12 40,686,097 (GRCm39) missense probably damaging 1.00
RF018:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
RF025:Dock4 UTSW 12 40,894,392 (GRCm39) frame shift probably null
RF063:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
X0028:Dock4 UTSW 12 40,719,046 (GRCm39) missense probably benign 0.25
Z1176:Dock4 UTSW 12 40,681,615 (GRCm39) missense probably benign 0.16
Z1176:Dock4 UTSW 12 40,681,613 (GRCm39) missense probably benign 0.01
Z1177:Dock4 UTSW 12 40,867,640 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AAGAGGCAGCTGCAGACATC -3'
(R):5'- CTCTCATGATGCAGACAGAAACG -3'

Sequencing Primer
(F):5'- TCTGCCCCTGGTAAAAACAGTG -3'
(R):5'- CATGATGCAGACAGAAACGGAAATAG -3'
Posted On 2020-01-23