Incidental Mutation 'R8000:Actn1'
ID616332
Institutional Source Beutler Lab
Gene Symbol Actn1
Ensembl Gene ENSMUSG00000015143
Gene Nameactinin, alpha 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R8000 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location80167547-80260371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80199008 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 134 (F134L)
Ref Sequence ENSEMBL: ENSMUSP00000021554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]
Predicted Effect probably damaging
Transcript: ENSMUST00000021554
AA Change: F134L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: F134L

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 5.9e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 4.7e-14 PFAM
EFh 750 778 1.73e-5 SMART
EFh 791 819 8.13e-2 SMART
efhand_Ca_insen 822 888 5.22e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167327
AA Change: F134L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: F134L

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 1.7e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 8.4e-14 PFAM
EFh 750 778 1.36e0 SMART
EFh 786 814 8.13e-2 SMART
efhand_Ca_insen 817 883 5.22e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029I15Rik A G 2: 92,385,527 K69E unknown Het
4833423E24Rik A G 2: 85,518,726 V14A probably benign Het
Aadacl2 A G 3: 60,017,375 K121R possibly damaging Het
Acaca A G 11: 84,392,231 K2208E possibly damaging Het
Akt3 A T 1: 177,050,197 V335D probably damaging Het
Arhgef10 T G 8: 14,930,054 I98S probably damaging Het
Celf4 T C 18: 25,504,517 N209S probably benign Het
Col4a4 G A 1: 82,541,297 P59L unknown Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
Dock4 T A 12: 40,833,119 L1642I probably benign Het
Fam213a A C 14: 40,994,526 *230G probably null Het
Fap A G 2: 62,502,798 probably null Het
Fbxo18 A T 2: 11,767,289 Y194N probably benign Het
Fras1 A G 5: 96,762,677 T3322A probably damaging Het
Gabra4 A G 5: 71,623,961 F369S probably damaging Het
Igkv9-124 T A 6: 67,942,152 D92V probably damaging Het
Kcna6 C A 6: 126,738,985 E314* probably null Het
Kyat1 A C 2: 30,192,053 S25A probably benign Het
Lars2 G A 9: 123,436,244 G455D probably damaging Het
Mertk A G 2: 128,771,498 H478R probably benign Het
Mier1 A T 4: 103,131,043 T83S probably damaging Het
Mmp1a C A 9: 7,476,214 H437Q probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Neb G T 2: 52,288,844 A1300D probably damaging Het
Nell2 T A 15: 95,435,274 L167F probably damaging Het
Olfr1426 T C 19: 12,087,994 D266G probably damaging Het
Olfr239 G C 17: 33,199,347 A100P probably damaging Het
Olfr527 T A 7: 140,336,342 M160K possibly damaging Het
Pald1 T C 10: 61,347,439 T339A probably benign Het
Pex13 A C 11: 23,655,915 L105W probably damaging Het
Ptprd A C 4: 76,066,242 F556V possibly damaging Het
Rgp1 T A 4: 43,581,664 C314S probably benign Het
Rnaseh2a G A 8: 84,966,049 probably benign Het
Rpl7 A T 1: 16,102,725 M154K probably benign Het
Samd9l A T 6: 3,373,034 L1409Q probably damaging Het
Slc35f3 A G 8: 126,321,073 T51A probably benign Het
Slc7a10 A G 7: 35,200,440 Y76C Het
Slk G T 19: 47,608,905 A51S Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Stk38 A T 17: 28,992,448 V51E probably benign Het
Tecta A T 9: 42,367,184 C1009* probably null Het
Vmn1r228 A T 17: 20,776,965 M97K possibly damaging Het
Xpo4 T C 14: 57,589,946 D931G probably damaging Het
Zfp503 T C 14: 21,986,159 T230A possibly damaging Het
Other mutations in Actn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Actn1 APN 12 80199072 splice site probably null
IGL01152:Actn1 APN 12 80199046 missense probably damaging 1.00
IGL01386:Actn1 APN 12 80193672 missense probably benign 0.03
IGL01890:Actn1 APN 12 80184868 missense probably damaging 0.99
IGL01937:Actn1 APN 12 80171763 missense probably benign 0.03
IGL02142:Actn1 APN 12 80176155 critical splice donor site probably null
IGL02191:Actn1 APN 12 80174109 missense probably benign
IGL02217:Actn1 APN 12 80174094 nonsense probably null
IGL02230:Actn1 APN 12 80171830 missense probably benign 0.02
IGL03163:Actn1 APN 12 80181417 missense probably benign 0.33
IGL03401:Actn1 APN 12 80168967 nonsense probably null
R0538:Actn1 UTSW 12 80260100 unclassified probably benign
R0546:Actn1 UTSW 12 80178434 missense probably benign
R0583:Actn1 UTSW 12 80199029 missense probably damaging 1.00
R0606:Actn1 UTSW 12 80174647 splice site probably benign
R1340:Actn1 UTSW 12 80173144 critical splice acceptor site probably null
R1519:Actn1 UTSW 12 80205078 missense probably damaging 1.00
R1572:Actn1 UTSW 12 80172957 splice site probably benign
R1619:Actn1 UTSW 12 80173022 missense probably damaging 1.00
R1677:Actn1 UTSW 12 80260032 missense probably benign 0.02
R1994:Actn1 UTSW 12 80204971 nonsense probably null
R2102:Actn1 UTSW 12 80183517 missense probably benign 0.38
R2157:Actn1 UTSW 12 80173117 missense probably benign 0.04
R2191:Actn1 UTSW 12 80171802 nonsense probably null
R2519:Actn1 UTSW 12 80192389 missense probably damaging 1.00
R2988:Actn1 UTSW 12 80192388 missense possibly damaging 0.78
R4024:Actn1 UTSW 12 80168477 missense probably damaging 1.00
R4589:Actn1 UTSW 12 80171799 missense possibly damaging 0.53
R4907:Actn1 UTSW 12 80181414 missense probably damaging 0.99
R4936:Actn1 UTSW 12 80172998 missense probably benign 0.09
R4966:Actn1 UTSW 12 80173130 missense probably benign 0.01
R4972:Actn1 UTSW 12 80173039 missense probably benign 0.35
R5395:Actn1 UTSW 12 80170703 missense probably benign
R5460:Actn1 UTSW 12 80183568 missense probably benign 0.00
R5467:Actn1 UTSW 12 80176217 missense possibly damaging 0.86
R5470:Actn1 UTSW 12 80168941 missense probably damaging 0.99
R5661:Actn1 UTSW 12 80184844 missense probably benign 0.09
R5985:Actn1 UTSW 12 80168395 missense probably damaging 1.00
R6020:Actn1 UTSW 12 80174455 splice site probably null
R6042:Actn1 UTSW 12 80177249 missense probably benign 0.04
R6389:Actn1 UTSW 12 80174522 missense probably benign
R6499:Actn1 UTSW 12 80168417 missense possibly damaging 0.59
R6709:Actn1 UTSW 12 80193644 missense probably damaging 1.00
R7016:Actn1 UTSW 12 80172968 missense possibly damaging 0.94
R7116:Actn1 UTSW 12 80204977 missense probably damaging 1.00
R7173:Actn1 UTSW 12 80177259 missense possibly damaging 0.70
R7183:Actn1 UTSW 12 80168932 missense possibly damaging 0.87
R7291:Actn1 UTSW 12 80174085 missense probably benign 0.00
R7361:Actn1 UTSW 12 80193715 missense probably benign 0.01
R7452:Actn1 UTSW 12 80183602 missense probably benign 0.12
R7698:Actn1 UTSW 12 80174537 missense probably benign 0.00
R7701:Actn1 UTSW 12 80174554 missense possibly damaging 0.88
R8171:Actn1 UTSW 12 80196393 critical splice donor site probably null
R8287:Actn1 UTSW 12 80174078 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAAAGCCAGAAATGCCGCTG -3'
(R):5'- TGTGAGTTTAATCCCTTGCGC -3'

Sequencing Primer
(F):5'- CCGCTGGGCTGACATACTTTTG -3'
(R):5'- GAGTTTAATCCCTTGCGCAAATAAAC -3'
Posted On2020-01-23