Incidental Mutation 'R8001:Itpkb'
ID616347
Institutional Source Beutler Lab
Gene Symbol Itpkb
Ensembl Gene ENSMUSG00000038855
Gene Nameinositol 1,4,5-trisphosphate 3-kinase B
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock #R8001 (G1)
Quality Score213.009
Status Not validated
Chromosome1
Chromosomal Location180330485-180424802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180332494 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 62 (S62P)
Ref Sequence ENSEMBL: ENSMUSP00000069851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070181]
PDB Structure
Crystal Structure of the Catalytic and CaM-Binding domains of Inositol 1,4,5-Trisphosphate 3-Kinase B [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000070181
AA Change: S62P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069851
Gene: ENSMUSG00000038855
AA Change: S62P

DomainStartEndE-ValueType
low complexity region 68 106 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
low complexity region 595 618 N/A INTRINSIC
Pfam:IPK 722 933 3.5e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this protein regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of this encoded protein is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. Both calcium/calmodulin and protein phosphorylation mechanisms control its activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in a block of thymocyte development at the double positive stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A G 1: 93,154,599 L266P probably damaging Het
Acr A G 15: 89,573,962 Y282C probably damaging Het
Alkbh4 A G 5: 136,140,269 R136G probably damaging Het
Bptf C A 11: 107,047,340 E2* probably null Het
Cse1l T A 2: 166,939,913 F659Y probably damaging Het
Ctrc A T 4: 141,840,360 L144Q probably damaging Het
Elmo1 A G 13: 20,286,732 I265V probably benign Het
Erich3 T C 3: 154,713,916 S19P probably benign Het
Hmcn1 A T 1: 150,664,878 C2893* probably null Het
Hnrnpll G A 17: 80,038,723 Q370* probably null Het
Lig3 T A 11: 82,792,076 C501S probably benign Het
Nrxn1 C T 17: 91,088,536 R64H possibly damaging Het
Ogfod2 T G 5: 124,114,883 C319G probably damaging Het
Olfr1474 A G 19: 13,471,422 I109V probably benign Het
Olfr201 T C 16: 59,269,109 N186S probably benign Het
Olfr555 A T 7: 102,659,034 D71V probably damaging Het
Olfr827 A G 10: 130,210,860 V90A probably benign Het
Pabpc6 C A 17: 9,669,373 R83L probably damaging Het
Pcdhgb2 A T 18: 37,690,634 Q226L probably benign Het
Pole A T 5: 110,312,734 I1127F probably damaging Het
Psg22 A T 7: 18,719,746 Q161L possibly damaging Het
Slc17a7 A T 7: 45,168,788 T46S probably benign Het
Smad4 A G 18: 73,641,810 S473P probably damaging Het
Snap47 T A 11: 59,438,354 T41S probably benign Het
Snx21 T C 2: 164,786,737 L100P probably benign Het
Stc1 T A 14: 69,038,395 N212K probably benign Het
Stk32a A T 18: 43,315,144 N396I possibly damaging Het
Stox2 G A 8: 47,186,477 P894L probably benign Het
Trav16d-dv11 A G 14: 53,047,287 M1V probably null Het
Trim33 T C 3: 103,311,515 probably null Het
Tyrp1 T C 4: 80,840,670 V260A probably benign Het
Ush2a T C 1: 188,911,064 Y4208H probably damaging Het
Vmn1r25 T A 6: 57,979,080 K75* probably null Het
Vmn2r117 T A 17: 23,479,407 N64I possibly damaging Het
Wdfy4 C T 14: 32,973,535 probably null Het
Wnt8a A T 18: 34,545,516 I128F probably damaging Het
Zc3h7b C A 15: 81,779,260 Y484* probably null Het
Zfp619 A G 7: 39,535,221 K225R probably benign Het
Other mutations in Itpkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Itpkb APN 1 180332993 missense probably benign
IGL01733:Itpkb APN 1 180333169 missense possibly damaging 0.50
IGL01812:Itpkb APN 1 180420286 missense probably damaging 1.00
IGL01965:Itpkb APN 1 180332405 missense probably damaging 1.00
IGL02447:Itpkb APN 1 180421354 splice site probably benign
IGL03143:Itpkb APN 1 180333368 missense probably benign
IGL03228:Itpkb APN 1 180413999 missense probably damaging 1.00
lahar UTSW 1 180327225 unclassified probably benign
magma UTSW 1 180413975 missense probably damaging 1.00
Purpura UTSW 1 180334096 missense probably damaging 1.00
Pyroclastic UTSW 1 180334253 intron probably benign
volcano UTSW 1 180421315 missense probably damaging 1.00
IGL02991:Itpkb UTSW 1 180327714 unclassified probably benign
R0071:Itpkb UTSW 1 180332765 missense probably damaging 1.00
R0471:Itpkb UTSW 1 180418255 missense probably damaging 0.98
R0616:Itpkb UTSW 1 180421736 missense probably damaging 1.00
R1567:Itpkb UTSW 1 180421858 missense probably benign 0.00
R2060:Itpkb UTSW 1 180421858 missense probably benign 0.00
R2474:Itpkb UTSW 1 180334151 missense probably damaging 1.00
R3022:Itpkb UTSW 1 180418323 missense probably damaging 0.96
R3792:Itpkb UTSW 1 180333173 missense possibly damaging 0.81
R3831:Itpkb UTSW 1 180333695 missense probably benign 0.00
R3833:Itpkb UTSW 1 180333695 missense probably benign 0.00
R3967:Itpkb UTSW 1 180327798 unclassified probably benign
R3968:Itpkb UTSW 1 180327798 unclassified probably benign
R4735:Itpkb UTSW 1 180418215 missense probably damaging 1.00
R4774:Itpkb UTSW 1 180418194 missense probably damaging 1.00
R4807:Itpkb UTSW 1 180334875 intron probably benign
R4895:Itpkb UTSW 1 180413895 missense probably damaging 1.00
R5514:Itpkb UTSW 1 180413909 missense probably damaging 1.00
R5593:Itpkb UTSW 1 180334096 missense probably damaging 1.00
R5633:Itpkb UTSW 1 180327225 unclassified probably benign
R5772:Itpkb UTSW 1 180334253 intron probably benign
R5898:Itpkb UTSW 1 180421315 missense probably damaging 1.00
R5903:Itpkb UTSW 1 180413975 missense probably damaging 1.00
R7060:Itpkb UTSW 1 180333130 missense probably damaging 1.00
R7689:Itpkb UTSW 1 180413979 missense probably damaging 1.00
R7816:Itpkb UTSW 1 180413889 missense probably damaging 1.00
R8155:Itpkb UTSW 1 180332348 missense possibly damaging 0.86
RF008:Itpkb UTSW 1 180333322 missense probably damaging 0.99
RF017:Itpkb UTSW 1 180333322 missense probably damaging 0.99
RF018:Itpkb UTSW 1 180333322 missense probably damaging 0.99
X0066:Itpkb UTSW 1 180421780 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTATGCCCTCAATAGCCTG -3'
(R):5'- AGAATCCGCAGCTTCCTCTG -3'

Sequencing Primer
(F):5'- CTCAATAGCCTGGTGATCATGAACAG -3'
(R):5'- GCAGCTTCCTCTGGGCCTC -3'
Posted On2020-01-23