Incidental Mutation 'R8001:Cse1l'
ID 616350
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1-like (S. cerevisiae)
Synonyms Capts, Xpo2, 2610100P18Rik, Cas
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 166906040-166946389 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 166939913 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 659 (F659Y)
Ref Sequence ENSEMBL: ENSMUSP00000002790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably damaging
Transcript: ENSMUST00000002790
AA Change: F659Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: F659Y

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163437
AA Change: F346Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: F346Y

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164974
SMART Domains Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:CAS_CSE1 24 72 5.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168599
AA Change: F603Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: F603Y

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169290
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A G 1: 93,154,599 L266P probably damaging Het
Acr A G 15: 89,573,962 Y282C probably damaging Het
Alkbh4 A G 5: 136,140,269 R136G probably damaging Het
Bptf C A 11: 107,047,340 E2* probably null Het
Ctrc A T 4: 141,840,360 L144Q probably damaging Het
Elmo1 A G 13: 20,286,732 I265V probably benign Het
Erich3 T C 3: 154,713,916 S19P probably benign Het
Hmcn1 A T 1: 150,664,878 C2893* probably null Het
Hnrnpll G A 17: 80,038,723 Q370* probably null Het
Itpkb T C 1: 180,332,494 S62P probably damaging Het
Lig3 T A 11: 82,792,076 C501S probably benign Het
Nrxn1 C T 17: 91,088,536 R64H possibly damaging Het
Ogfod2 T G 5: 124,114,883 C319G probably damaging Het
Olfr1474 A G 19: 13,471,422 I109V probably benign Het
Olfr201 T C 16: 59,269,109 N186S probably benign Het
Olfr555 A T 7: 102,659,034 D71V probably damaging Het
Olfr827 A G 10: 130,210,860 V90A probably benign Het
Pabpc6 C A 17: 9,669,373 R83L probably damaging Het
Pcdhgb2 A T 18: 37,690,634 Q226L probably benign Het
Pole A T 5: 110,312,734 I1127F probably damaging Het
Psg22 A T 7: 18,719,746 Q161L possibly damaging Het
Slc17a7 A T 7: 45,168,788 T46S probably benign Het
Smad4 A G 18: 73,641,810 S473P probably damaging Het
Snap47 T A 11: 59,438,354 T41S probably benign Het
Snx21 T C 2: 164,786,737 L100P probably benign Het
Stc1 T A 14: 69,038,395 N212K probably benign Het
Stk32a A T 18: 43,315,144 N396I possibly damaging Het
Stox2 G A 8: 47,186,477 P894L probably benign Het
Trav16d-dv11 A G 14: 53,047,287 M1V probably null Het
Trim33 T C 3: 103,311,515 probably null Het
Tyrp1 T C 4: 80,840,670 V260A probably benign Het
Ush2a T C 1: 188,911,064 Y4208H probably damaging Het
Vmn1r25 T A 6: 57,979,080 K75* probably null Het
Vmn2r117 T A 17: 23,479,407 N64I possibly damaging Het
Wdfy4 C T 14: 32,973,535 probably null Het
Wnt8a A T 18: 34,545,516 I128F probably damaging Het
Zc3h7b C A 15: 81,779,260 Y484* probably null Het
Zfp619 A G 7: 39,535,221 K225R probably benign Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166927804 missense probably damaging 1.00
IGL01306:Cse1l APN 2 166927508 nonsense probably null
IGL01672:Cse1l APN 2 166929967 missense probably damaging 1.00
IGL02060:Cse1l APN 2 166930653 missense probably damaging 1.00
IGL02897:Cse1l APN 2 166919708 missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166943057 splice site probably benign
ANU23:Cse1l UTSW 2 166927508 nonsense probably null
PIT4585001:Cse1l UTSW 2 166941474 missense probably damaging 1.00
R0195:Cse1l UTSW 2 166940088 missense probably benign
R1114:Cse1l UTSW 2 166941203 splice site probably benign
R1539:Cse1l UTSW 2 166926372 missense probably benign 0.00
R1721:Cse1l UTSW 2 166926411 missense probably damaging 1.00
R1779:Cse1l UTSW 2 166940124 splice site probably null
R1913:Cse1l UTSW 2 166922191 missense probably damaging 1.00
R2069:Cse1l UTSW 2 166941492 missense probably benign 0.01
R2398:Cse1l UTSW 2 166928997 missense probably damaging 1.00
R4110:Cse1l UTSW 2 166942050 missense probably benign 0.00
R4195:Cse1l UTSW 2 166929979 missense probably damaging 1.00
R4603:Cse1l UTSW 2 166944532 missense probably benign 0.09
R4686:Cse1l UTSW 2 166932160 missense probably damaging 1.00
R4867:Cse1l UTSW 2 166926403 missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166929794 missense probably damaging 1.00
R5164:Cse1l UTSW 2 166944428 missense probably benign 0.02
R5475:Cse1l UTSW 2 166941254 missense probably damaging 1.00
R5493:Cse1l UTSW 2 166941190 intron probably benign
R5782:Cse1l UTSW 2 166929001 missense probably damaging 1.00
R5862:Cse1l UTSW 2 166915207 missense probably benign 0.00
R6030:Cse1l UTSW 2 166919621 missense probably benign 0.01
R6030:Cse1l UTSW 2 166919621 missense probably benign 0.01
R6913:Cse1l UTSW 2 166929877 missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166922788 missense probably benign
R7871:Cse1l UTSW 2 166935671 splice site probably null
R8057:Cse1l UTSW 2 166939925 missense probably damaging 1.00
R8175:Cse1l UTSW 2 166943208 critical splice donor site probably null
R8347:Cse1l UTSW 2 166927585 missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166919684 missense probably benign 0.00
R8479:Cse1l UTSW 2 166921973 missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166943080 missense probably damaging 1.00
R9206:Cse1l UTSW 2 166941265 missense probably damaging 1.00
R9208:Cse1l UTSW 2 166941265 missense probably damaging 1.00
R9522:Cse1l UTSW 2 166934753 missense probably benign
R9599:Cse1l UTSW 2 166941466 missense probably benign
R9600:Cse1l UTSW 2 166915199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAAGCTAACCCTGCTGC -3'
(R):5'- CAGTTGCTATTGTACTTGAGCC -3'

Sequencing Primer
(F):5'- AAAGCTAACCCTGCTGCTGTTG -3'
(R):5'- CCTCGTTCTAAGAATGCCTGGAG -3'
Posted On 2020-01-23