Mutagenetix > Incidental Mutation

Incidental Mutation 'R8001:Trim33'

616351

Institutional Source

Beutler Lab

Gene Symbol

Trim33

Ensembl Gene

ENSMUSG00000033014

Gene Name

tripartite motif-containing 33

Synonyms

ectodermin, Ecto, 8030451N04Rik, Tif1g

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103279293-103358775 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 103311515 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000029444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029444] [ENSMUST00000106860]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000029444

SMART Domains

Protein: ENSMUSP00000029444
Gene: ENSMUSG00000033014

Domain	Start	End	E-Value	Type
low complexity region	6	31	N/A	INTRINSIC
low complexity region	33	134	N/A	INTRINSIC
PHD	138	199	9.85e0	SMART
RING	139	198	2.12e-8	SMART
BBOX	226	273	1.24e-9	SMART
RING	231	293	2.01e0	SMART
BBOX	285	326	1.54e-10	SMART
BBC	333	459	7.55e-45	SMART
low complexity region	540	583	N/A	INTRINSIC
low complexity region	731	773	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
PHD	902	945	4.15e-11	SMART
BROMO	972	1095	3.74e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106860

SMART Domains

Protein: ENSMUSP00000102473
Gene: ENSMUSG00000033014

Domain	Start	End	E-Value	Type
low complexity region	6	31	N/A	INTRINSIC
low complexity region	33	134	N/A	INTRINSIC
PHD	138	199	9.85e0	SMART
RING	139	198	2.12e-8	SMART
BBOX	226	273	1.24e-9	SMART
RING	231	293	2.01e0	SMART
BBOX	285	326	1.54e-10	SMART
BBC	333	459	7.55e-45	SMART
low complexity region	540	583	N/A	INTRINSIC
low complexity region	731	773	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
PHD	902	945	4.15e-11	SMART
BROMO	972	1078	3.52e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000197779

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a transcriptional corepressor. However, molecules that interact with this protein have not yet been identified. The protein is a member of the tripartite motif family. This motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Three alternatively spliced transcript variants for this gene have been described, however, the full-length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E9.5 with abnormal embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	A	G	1: 93,154,599	L266P	probably damaging	Het
Acr	A	G	15: 89,573,962	Y282C	probably damaging	Het
Alkbh4	A	G	5: 136,140,269	R136G	probably damaging	Het
Bptf	C	A	11: 107,047,340	E2*	probably null	Het
Cse1l	T	A	2: 166,939,913	F659Y	probably damaging	Het
Ctrc	A	T	4: 141,840,360	L144Q	probably damaging	Het
Elmo1	A	G	13: 20,286,732	I265V	probably benign	Het
Erich3	T	C	3: 154,713,916	S19P	probably benign	Het
Hmcn1	A	T	1: 150,664,878	C2893*	probably null	Het
Hnrnpll	G	A	17: 80,038,723	Q370*	probably null	Het
Itpkb	T	C	1: 180,332,494	S62P	probably damaging	Het
Lig3	T	A	11: 82,792,076	C501S	probably benign	Het
Nrxn1	C	T	17: 91,088,536	R64H	possibly damaging	Het
Ogfod2	T	G	5: 124,114,883	C319G	probably damaging	Het
Olfr1474	A	G	19: 13,471,422	I109V	probably benign	Het
Olfr201	T	C	16: 59,269,109	N186S	probably benign	Het
Olfr555	A	T	7: 102,659,034	D71V	probably damaging	Het
Olfr827	A	G	10: 130,210,860	V90A	probably benign	Het
Pabpc6	C	A	17: 9,669,373	R83L	probably damaging	Het
Pcdhgb2	A	T	18: 37,690,634	Q226L	probably benign	Het
Pole	A	T	5: 110,312,734	I1127F	probably damaging	Het
Psg22	A	T	7: 18,719,746	Q161L	possibly damaging	Het
Slc17a7	A	T	7: 45,168,788	T46S	probably benign	Het
Smad4	A	G	18: 73,641,810	S473P	probably damaging	Het
Snap47	T	A	11: 59,438,354	T41S	probably benign	Het
Snx21	T	C	2: 164,786,737	L100P	probably benign	Het
Stc1	T	A	14: 69,038,395	N212K	probably benign	Het
Stk32a	A	T	18: 43,315,144	N396I	possibly damaging	Het
Stox2	G	A	8: 47,186,477	P894L	probably benign	Het
Trav16d-dv11	A	G	14: 53,047,287	M1V	probably null	Het
Tyrp1	T	C	4: 80,840,670	V260A	probably benign	Het
Ush2a	T	C	1: 188,911,064	Y4208H	probably damaging	Het
Vmn1r25	T	A	6: 57,979,080	K75*	probably null	Het
Vmn2r117	T	A	17: 23,479,407	N64I	possibly damaging	Het
Wdfy4	C	T	14: 32,973,535		probably null	Het
Wnt8a	A	T	18: 34,545,516	I128F	probably damaging	Het
Zc3h7b	C	A	15: 81,779,260	Y484*	probably null	Het
Zfp619	A	G	7: 39,535,221	K225R	probably benign	Het

Other mutations in Trim33

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Trim33	APN	3	103330182	missense	probably benign	0.44
IGL00981:Trim33	APN	3	103351995	splice site	probably benign
IGL01010:Trim33	APN	3	103346715	nonsense	probably null
IGL01025:Trim33	APN	3	103353918	utr 3 prime	probably benign
IGL01082:Trim33	APN	3	103326859	missense	possibly damaging	0.49
IGL02245:Trim33	APN	3	103346770	critical splice donor site	probably null
IGL02291:Trim33	APN	3	103326865	missense	probably damaging	1.00
IGL03248:Trim33	APN	3	103310973	unclassified	probably benign
IGL03400:Trim33	APN	3	103329143	missense	probably damaging	0.99
abilene	UTSW	3	103321559	missense	probably damaging	0.99
Bemoaned	UTSW	3	103326793	missense	possibly damaging	0.92
Excision	UTSW	3	103344576	missense	probably damaging	1.00
Peaked	UTSW	3	103337532	critical splice donor site	probably null
Pike	UTSW	3	103310885	missense	probably damaging	0.98
westworld	UTSW	3	103326901	missense	possibly damaging	0.46
R0143:Trim33	UTSW	3	103352101	missense	probably benign	0.00
R0471:Trim33	UTSW	3	103326901	missense	possibly damaging	0.46
R0513:Trim33	UTSW	3	103310384	missense	probably damaging	1.00
R0573:Trim33	UTSW	3	103351990	splice site	probably benign
R0586:Trim33	UTSW	3	103310344	missense	probably damaging	0.99
R1103:Trim33	UTSW	3	103310885	missense	probably damaging	0.98
R1157:Trim33	UTSW	3	103353830	missense	probably damaging	1.00
R1328:Trim33	UTSW	3	103353597	missense	possibly damaging	0.86
R1331:Trim33	UTSW	3	103310354	missense	probably damaging	0.99
R1385:Trim33	UTSW	3	103310950	missense	possibly damaging	0.46
R1397:Trim33	UTSW	3	103310434	unclassified	probably benign
R1785:Trim33	UTSW	3	103329220	frame shift	probably null
R1848:Trim33	UTSW	3	103324640	unclassified	probably benign
R1903:Trim33	UTSW	3	103337444	missense	probably damaging	1.00
R3404:Trim33	UTSW	3	103321559	missense	probably damaging	0.99
R3878:Trim33	UTSW	3	103352005	missense	probably damaging	1.00
R4156:Trim33	UTSW	3	103310314	missense	possibly damaging	0.94
R4281:Trim33	UTSW	3	103329086	missense	probably damaging	0.99
R4570:Trim33	UTSW	3	103330165	missense	probably damaging	0.96
R4809:Trim33	UTSW	3	103329256	missense	possibly damaging	0.91
R4904:Trim33	UTSW	3	103331647	missense	possibly damaging	0.46
R5168:Trim33	UTSW	3	103341681	nonsense	probably null
R5458:Trim33	UTSW	3	103330180	missense	possibly damaging	0.64
R5910:Trim33	UTSW	3	103344576	missense	probably damaging	1.00
R6195:Trim33	UTSW	3	103337532	critical splice donor site	probably null
R6331:Trim33	UTSW	3	103341609	missense	probably benign	0.00
R6636:Trim33	UTSW	3	103353719	missense	probably damaging	1.00
R6642:Trim33	UTSW	3	103337514	missense	probably damaging	0.99
R6783:Trim33	UTSW	3	103352087	missense	probably damaging	1.00
R6856:Trim33	UTSW	3	103352049	missense	probably damaging	0.97
R7220:Trim33	UTSW	3	103326793	missense	possibly damaging	0.92
R7325:Trim33	UTSW	3	103321636	missense	possibly damaging	0.93
R7374:Trim33	UTSW	3	103310323	missense	probably damaging	0.98
R7430:Trim33	UTSW	3	103310903	missense	possibly damaging	0.92
R7438:Trim33	UTSW	3	103346640	splice site	probably benign
R7491:Trim33	UTSW	3	103326148	missense	probably benign	0.28
R8127:Trim33	UTSW	3	103331727	missense	possibly damaging	0.66
R8326:Trim33	UTSW	3	103311454	nonsense	probably null
R8334:Trim33	UTSW	3	103353829	missense	probably benign	0.06
R8813:Trim33	UTSW	3	103346736	missense	probably benign	0.01
R8828:Trim33	UTSW	3	103329076	missense	probably damaging	0.97
R8894:Trim33	UTSW	3	103311491	missense	probably damaging	1.00
R9239:Trim33	UTSW	3	103330137	missense	probably benign	0.08
R9433:Trim33	UTSW	3	103321663	critical splice donor site	probably null
R9495:Trim33	UTSW	3	103331758	missense	probably benign	0.17
R9514:Trim33	UTSW	3	103331758	missense	probably benign	0.17
R9564:Trim33	UTSW	3	103331649	missense	probably benign	0.28
R9595:Trim33	UTSW	3	103352034	missense	probably damaging	1.00
R9722:Trim33	UTSW	3	103353830	missense	possibly damaging	0.55
R9784:Trim33	UTSW	3	103337507	missense	possibly damaging	0.66
RF005:Trim33	UTSW	3	103280212	frame shift	probably null
RF007:Trim33	UTSW	3	103280217	small deletion	probably benign
RF014:Trim33	UTSW	3	103329092	missense	possibly damaging	0.94
RF061:Trim33	UTSW	3	103280217	small deletion	probably benign
RF064:Trim33	UTSW	3	103280195	frame shift	probably null
Z1176:Trim33	UTSW	3	103353727	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAATGACACATCTAACCGTTTGAAC -3'
(R):5'- GAGAACGTTTAACAGTCACCTCCATAC -3'

Sequencing Primer
(F):5'- ACCGTTTGAACTTAGAAATAGCATG -3'
(R):5'- TTTCATATCATACATAGCCACTAGCC -3'

Posted On

2020-01-23