Incidental Mutation 'R8001:Erich3'
ID 616352
Institutional Source Beutler Lab
Gene Symbol Erich3
Ensembl Gene ENSMUSG00000078161
Gene Name glutamate rich 3
Synonyms 5031409G23Rik, 4922501L14Rik
MMRRC Submission 046041-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 154416770-154454649 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 154419553 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 19 (S19P)
Ref Sequence ENSEMBL: ENSMUSP00000062837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051862] [ENSMUST00000098496]
AlphaFold F6QRE9
Predicted Effect probably benign
Transcript: ENSMUST00000051862
AA Change: S19P

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000062837
Gene: ENSMUSG00000078161
AA Change: S19P

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:DUF4590 102 217 9.8e-62 PFAM
low complexity region 299 327 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
low complexity region 408 420 N/A INTRINSIC
low complexity region 441 451 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000096097
Gene: ENSMUSG00000078161
AA Change: S216P

DomainStartEndE-ValueType
internal_repeat_1 18 102 3.73e-10 PROSPERO
internal_repeat_1 155 240 3.73e-10 PROSPERO
low complexity region 501 514 N/A INTRINSIC
low complexity region 756 773 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acr A G 15: 89,458,165 (GRCm39) Y282C probably damaging Het
Alkbh4 A G 5: 136,169,123 (GRCm39) R136G probably damaging Het
Bptf C A 11: 106,938,166 (GRCm39) E2* probably null Het
Cse1l T A 2: 166,781,833 (GRCm39) F659Y probably damaging Het
Ctrc A T 4: 141,567,671 (GRCm39) L144Q probably damaging Het
Elmo1 A G 13: 20,470,902 (GRCm39) I265V probably benign Het
Hmcn1 A T 1: 150,540,629 (GRCm39) C2893* probably null Het
Hnrnpll G A 17: 80,346,152 (GRCm39) Q370* probably null Het
Itpkb T C 1: 180,160,059 (GRCm39) S62P probably damaging Het
Lig3 T A 11: 82,682,902 (GRCm39) C501S probably benign Het
Mab21l4 A G 1: 93,082,321 (GRCm39) L266P probably damaging Het
Nrxn1 C T 17: 91,395,964 (GRCm39) R64H possibly damaging Het
Ogfod2 T G 5: 124,252,946 (GRCm39) C319G probably damaging Het
Or51h1 A T 7: 102,308,241 (GRCm39) D71V probably damaging Het
Or5ac19 T C 16: 59,089,472 (GRCm39) N186S probably benign Het
Or5b118 A G 19: 13,448,786 (GRCm39) I109V probably benign Het
Or9k7 A G 10: 130,046,729 (GRCm39) V90A probably benign Het
Pabpc6 C A 17: 9,888,302 (GRCm39) R83L probably damaging Het
Pcdhgb2 A T 18: 37,823,687 (GRCm39) Q226L probably benign Het
Pole A T 5: 110,460,600 (GRCm39) I1127F probably damaging Het
Psg22 A T 7: 18,453,671 (GRCm39) Q161L possibly damaging Het
Slc17a7 A T 7: 44,818,212 (GRCm39) T46S probably benign Het
Smad4 A G 18: 73,774,881 (GRCm39) S473P probably damaging Het
Snap47 T A 11: 59,329,180 (GRCm39) T41S probably benign Het
Snx21 T C 2: 164,628,657 (GRCm39) L100P probably benign Het
Stc1 T A 14: 69,275,844 (GRCm39) N212K probably benign Het
Stk32a A T 18: 43,448,209 (GRCm39) N396I possibly damaging Het
Stox2 G A 8: 47,639,512 (GRCm39) P894L probably benign Het
Trav16d-dv11 A G 14: 53,284,744 (GRCm39) M1V probably null Het
Trim33 T C 3: 103,218,831 (GRCm39) probably null Het
Tyrp1 T C 4: 80,758,907 (GRCm39) V260A probably benign Het
Ush2a T C 1: 188,643,261 (GRCm39) Y4208H probably damaging Het
Vmn1r25 T A 6: 57,956,065 (GRCm39) K75* probably null Het
Vmn2r117 T A 17: 23,698,381 (GRCm39) N64I possibly damaging Het
Wdfy4 C T 14: 32,695,492 (GRCm39) probably null Het
Wnt8a A T 18: 34,678,569 (GRCm39) I128F probably damaging Het
Zc3h7b C A 15: 81,663,461 (GRCm39) Y484* probably null Het
Zfp619 A G 7: 39,184,645 (GRCm39) K225R probably benign Het
Other mutations in Erich3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Erich3 APN 3 154,454,156 (GRCm39) missense probably benign 0.44
IGL01141:Erich3 APN 3 154,419,653 (GRCm39) missense probably benign 0.08
IGL01812:Erich3 APN 3 154,419,608 (GRCm39) missense possibly damaging 0.70
IGL02126:Erich3 APN 3 154,419,599 (GRCm39) missense possibly damaging 0.60
IGL03371:Erich3 APN 3 154,433,114 (GRCm39) missense probably damaging 0.97
IGL03386:Erich3 APN 3 154,444,876 (GRCm39) missense possibly damaging 0.80
FR4449:Erich3 UTSW 3 154,469,150 (GRCm39) unclassified probably benign
R0942:Erich3 UTSW 3 154,444,788 (GRCm39) missense probably benign 0.00
R1558:Erich3 UTSW 3 154,419,705 (GRCm39) missense probably damaging 0.99
R1582:Erich3 UTSW 3 154,469,960 (GRCm39) unclassified probably benign
R1674:Erich3 UTSW 3 154,468,260 (GRCm39) unclassified probably benign
R1676:Erich3 UTSW 3 154,468,260 (GRCm39) unclassified probably benign
R1724:Erich3 UTSW 3 154,467,964 (GRCm39) missense possibly damaging 0.89
R1757:Erich3 UTSW 3 154,401,402 (GRCm39) missense probably damaging 0.98
R1771:Erich3 UTSW 3 154,454,109 (GRCm39) missense possibly damaging 0.82
R2384:Erich3 UTSW 3 154,470,288 (GRCm39) missense possibly damaging 0.92
R2410:Erich3 UTSW 3 154,439,240 (GRCm39) missense probably damaging 0.98
R2507:Erich3 UTSW 3 154,404,296 (GRCm39) missense probably null 1.00
R3621:Erich3 UTSW 3 154,454,369 (GRCm39) missense possibly damaging 0.83
R3755:Erich3 UTSW 3 154,469,958 (GRCm39) unclassified probably benign
R3756:Erich3 UTSW 3 154,470,215 (GRCm39) missense possibly damaging 0.66
R3756:Erich3 UTSW 3 154,469,958 (GRCm39) unclassified probably benign
R3832:Erich3 UTSW 3 154,467,998 (GRCm39) missense probably damaging 0.97
R4020:Erich3 UTSW 3 154,419,686 (GRCm39) missense probably damaging 0.97
R4601:Erich3 UTSW 3 154,470,375 (GRCm39) missense unknown
R4628:Erich3 UTSW 3 154,469,324 (GRCm39) missense probably damaging 1.00
R4841:Erich3 UTSW 3 154,410,480 (GRCm39) missense possibly damaging 0.87
R4842:Erich3 UTSW 3 154,410,480 (GRCm39) missense possibly damaging 0.87
R4863:Erich3 UTSW 3 154,470,441 (GRCm39) missense unknown
R4989:Erich3 UTSW 3 154,454,025 (GRCm39) missense possibly damaging 0.85
R5310:Erich3 UTSW 3 154,469,217 (GRCm39) missense probably damaging 1.00
R5596:Erich3 UTSW 3 154,433,033 (GRCm39) missense probably damaging 0.99
R5695:Erich3 UTSW 3 154,439,210 (GRCm39) missense probably damaging 1.00
R5742:Erich3 UTSW 3 154,438,960 (GRCm39) missense probably damaging 1.00
R5859:Erich3 UTSW 3 154,468,134 (GRCm39) missense possibly damaging 0.90
R5916:Erich3 UTSW 3 154,401,460 (GRCm39) missense probably damaging 1.00
R6172:Erich3 UTSW 3 154,469,978 (GRCm39) missense possibly damaging 0.66
R6321:Erich3 UTSW 3 154,433,139 (GRCm39) missense probably damaging 1.00
R6438:Erich3 UTSW 3 154,401,390 (GRCm39) missense probably damaging 1.00
R6520:Erich3 UTSW 3 154,469,102 (GRCm39) missense probably damaging 0.98
R6679:Erich3 UTSW 3 154,468,066 (GRCm39) missense possibly damaging 0.81
R6697:Erich3 UTSW 3 154,469,907 (GRCm39) unclassified probably benign
R6800:Erich3 UTSW 3 154,433,029 (GRCm39) critical splice acceptor site probably null
R6823:Erich3 UTSW 3 154,433,074 (GRCm39) missense probably damaging 1.00
R6855:Erich3 UTSW 3 154,468,286 (GRCm39) nonsense probably null
R6989:Erich3 UTSW 3 154,469,314 (GRCm39) unclassified probably benign
R7400:Erich3 UTSW 3 154,468,214 (GRCm39) missense
R7421:Erich3 UTSW 3 154,439,198 (GRCm39) missense probably damaging 1.00
R7520:Erich3 UTSW 3 154,468,763 (GRCm39) missense unknown
R7553:Erich3 UTSW 3 154,439,137 (GRCm39) missense probably benign 0.01
R7751:Erich3 UTSW 3 154,469,426 (GRCm39) missense unknown
R7768:Erich3 UTSW 3 154,453,968 (GRCm39) missense probably benign 0.00
R7955:Erich3 UTSW 3 154,444,951 (GRCm39) nonsense probably null
R8101:Erich3 UTSW 3 154,439,150 (GRCm39) missense probably damaging 0.99
R8108:Erich3 UTSW 3 154,425,752 (GRCm39) missense possibly damaging 0.91
R8162:Erich3 UTSW 3 154,470,210 (GRCm39) missense unknown
R8310:Erich3 UTSW 3 154,410,586 (GRCm39) missense
R8360:Erich3 UTSW 3 154,469,991 (GRCm39) missense unknown
R8418:Erich3 UTSW 3 154,415,378 (GRCm39) missense
R8490:Erich3 UTSW 3 154,401,461 (GRCm39) missense
R8545:Erich3 UTSW 3 154,467,996 (GRCm39) unclassified probably benign
R8813:Erich3 UTSW 3 154,468,827 (GRCm39) missense unknown
R8944:Erich3 UTSW 3 154,462,692 (GRCm39) missense
R8987:Erich3 UTSW 3 154,415,340 (GRCm39) missense
R9036:Erich3 UTSW 3 154,468,886 (GRCm39) missense unknown
R9135:Erich3 UTSW 3 154,467,912 (GRCm39) missense
R9175:Erich3 UTSW 3 154,419,601 (GRCm39) missense probably benign 0.02
R9284:Erich3 UTSW 3 154,404,308 (GRCm39) missense
R9339:Erich3 UTSW 3 154,468,872 (GRCm39) missense unknown
R9626:Erich3 UTSW 3 154,444,730 (GRCm39) missense probably benign 0.10
Z1176:Erich3 UTSW 3 154,468,067 (GRCm39) missense
Z1176:Erich3 UTSW 3 154,404,338 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GATTTTCATAGGCAGGAGCATGC -3'
(R):5'- AAAGATCACGTTGGCCATAATCAC -3'

Sequencing Primer
(F):5'- CAGGAGCATGCGTTTTATCAGCC -3'
(R):5'- TTGGCCATAATCACCTTGGCAAAG -3'
Posted On 2020-01-23