Mutagenetix > Incidental Mutation

Incidental Mutation 'R8001:Tyrp1'

616353

Institutional Source

Beutler Lab

Gene Symbol

Tyrp1

Ensembl Gene

ENSMUSG00000005994

Gene Name

tyrosinase-related protein 1

Synonyms

Tyrp, isa, Oca3, TRP1, TRP-1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R8001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80834123-80851719 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80840670 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 260 (V260A)

Ref Sequence

ENSEMBL: ENSMUSP00000006151 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006151] [ENSMUST00000102831] [ENSMUST00000133655]

AlphaFold

P07147

Predicted Effect

probably benign
Transcript: ENSMUST00000006151
AA Change: V260A

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000006151
Gene: ENSMUSG00000005994
AA Change: V260A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Tyrosinase	182	417	1.7e-37	PFAM
transmembrane domain	479	501	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102831
AA Change: V260A

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000099895
Gene: ENSMUSG00000005994
AA Change: V260A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Tyrosinase	182	417	4.9e-38	PFAM
transmembrane domain	479	501	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133655

SMART Domains

Protein: ENSMUSP00000117080
Gene: ENSMUSG00000005994

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Tyrosinase	182	229	1.1e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a melanosomal enzyme that belongs to the tyrosinase family and plays an important role in the melanin biosynthetic pathway. Defects in this gene are the cause of rufous oculocutaneous albinism and oculocutaneous albinism type III. [provided by RefSeq, Mar 2009]
PHENOTYPE: The major influence of mutations at this locus is to change eumelanin from a black to a brown pigment in the coat and eyes in varying degrees. Semidominant mutants result in melanocyte degeneration causing reduced pigmentation and progressive hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	A	G	1: 93,154,599	L266P	probably damaging	Het
Acr	A	G	15: 89,573,962	Y282C	probably damaging	Het
Alkbh4	A	G	5: 136,140,269	R136G	probably damaging	Het
Bptf	C	A	11: 107,047,340	E2*	probably null	Het
Cse1l	T	A	2: 166,939,913	F659Y	probably damaging	Het
Ctrc	A	T	4: 141,840,360	L144Q	probably damaging	Het
Elmo1	A	G	13: 20,286,732	I265V	probably benign	Het
Erich3	T	C	3: 154,713,916	S19P	probably benign	Het
Hmcn1	A	T	1: 150,664,878	C2893*	probably null	Het
Hnrnpll	G	A	17: 80,038,723	Q370*	probably null	Het
Itpkb	T	C	1: 180,332,494	S62P	probably damaging	Het
Lig3	T	A	11: 82,792,076	C501S	probably benign	Het
Nrxn1	C	T	17: 91,088,536	R64H	possibly damaging	Het
Ogfod2	T	G	5: 124,114,883	C319G	probably damaging	Het
Olfr1474	A	G	19: 13,471,422	I109V	probably benign	Het
Olfr201	T	C	16: 59,269,109	N186S	probably benign	Het
Olfr555	A	T	7: 102,659,034	D71V	probably damaging	Het
Olfr827	A	G	10: 130,210,860	V90A	probably benign	Het
Pabpc6	C	A	17: 9,669,373	R83L	probably damaging	Het
Pcdhgb2	A	T	18: 37,690,634	Q226L	probably benign	Het
Pole	A	T	5: 110,312,734	I1127F	probably damaging	Het
Psg22	A	T	7: 18,719,746	Q161L	possibly damaging	Het
Slc17a7	A	T	7: 45,168,788	T46S	probably benign	Het
Smad4	A	G	18: 73,641,810	S473P	probably damaging	Het
Snap47	T	A	11: 59,438,354	T41S	probably benign	Het
Snx21	T	C	2: 164,786,737	L100P	probably benign	Het
Stc1	T	A	14: 69,038,395	N212K	probably benign	Het
Stk32a	A	T	18: 43,315,144	N396I	possibly damaging	Het
Stox2	G	A	8: 47,186,477	P894L	probably benign	Het
Trav16d-dv11	A	G	14: 53,047,287	M1V	probably null	Het
Trim33	T	C	3: 103,311,515		probably null	Het
Ush2a	T	C	1: 188,911,064	Y4208H	probably damaging	Het
Vmn1r25	T	A	6: 57,979,080	K75*	probably null	Het
Vmn2r117	T	A	17: 23,479,407	N64I	possibly damaging	Het
Wdfy4	C	T	14: 32,973,535		probably null	Het
Wnt8a	A	T	18: 34,545,516	I128F	probably damaging	Het
Zc3h7b	C	A	15: 81,779,260	Y484*	probably null	Het
Zfp619	A	G	7: 39,535,221	K225R	probably benign	Het

Other mutations in Tyrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01508:Tyrp1	APN	4	80840765	missense	possibly damaging	0.95
IGL01586:Tyrp1	APN	4	80844898	missense	probably benign	0.00
IGL01620:Tyrp1	APN	4	80844802	nonsense	probably null
IGL02126:Tyrp1	APN	4	80837608	nonsense	probably null
IGL02174:Tyrp1	APN	4	80844826	nonsense	probably null
IGL02601:Tyrp1	APN	4	80840775	missense	probably null	0.00
IGL02630:Tyrp1	APN	4	80840757	missense	possibly damaging	0.95
Browncoat	UTSW	4	80835162	missense	probably damaging	1.00
butter	UTSW	4	80840806	critical splice donor site	probably null
ca-los	UTSW	4	80844868	nonsense	probably null
chi	UTSW	4	80840778	missense	probably damaging	1.00
R0011:Tyrp1	UTSW	4	80840793	missense	probably damaging	1.00
R0011:Tyrp1	UTSW	4	80840793	missense	probably damaging	1.00
R0145:Tyrp1	UTSW	4	80840778	missense	probably damaging	1.00
R1172:Tyrp1	UTSW	4	80844868	nonsense	probably null
R1173:Tyrp1	UTSW	4	80844868	nonsense	probably null
R1175:Tyrp1	UTSW	4	80844868	nonsense	probably null
R1886:Tyrp1	UTSW	4	80840806	critical splice donor site	probably null
R2099:Tyrp1	UTSW	4	80835379	missense	possibly damaging	0.69
R2273:Tyrp1	UTSW	4	80837534	missense	probably damaging	0.99
R2274:Tyrp1	UTSW	4	80837534	missense	probably damaging	0.99
R2275:Tyrp1	UTSW	4	80837534	missense	probably damaging	0.99
R2312:Tyrp1	UTSW	4	80837564	nonsense	probably null
R2427:Tyrp1	UTSW	4	80850871	missense	probably benign	0.00
R2440:Tyrp1	UTSW	4	80846606	missense	probably benign	0.41
R2915:Tyrp1	UTSW	4	80837455	missense	possibly damaging	0.46
R4343:Tyrp1	UTSW	4	80849841	missense	possibly damaging	0.92
R4512:Tyrp1	UTSW	4	80837512	missense	probably damaging	1.00
R4703:Tyrp1	UTSW	4	80840806	critical splice donor site	probably null
R4732:Tyrp1	UTSW	4	80844935	missense	possibly damaging	0.67
R4733:Tyrp1	UTSW	4	80844935	missense	possibly damaging	0.67
R4788:Tyrp1	UTSW	4	80844943	nonsense	probably null
R4834:Tyrp1	UTSW	4	80846596	nonsense	probably null
R4911:Tyrp1	UTSW	4	80850907	utr 3 prime	probably benign
R4938:Tyrp1	UTSW	4	80840646	missense	probably damaging	1.00
R5129:Tyrp1	UTSW	4	80846607	missense	probably damaging	1.00
R5154:Tyrp1	UTSW	4	80850717	missense	probably benign	0.00
R6249:Tyrp1	UTSW	4	80850772	missense	possibly damaging	0.93
R6492:Tyrp1	UTSW	4	80840781	missense	probably null	1.00
R6617:Tyrp1	UTSW	4	80846747	missense	probably benign	0.24
R6870:Tyrp1	UTSW	4	80850777	missense	probably benign	0.37
R6990:Tyrp1	UTSW	4	80835437	missense	probably damaging	1.00
R7275:Tyrp1	UTSW	4	80837584	missense	possibly damaging	0.78
R7684:Tyrp1	UTSW	4	80840625	missense	probably damaging	1.00
R7980:Tyrp1	UTSW	4	80840627	missense	probably damaging	1.00
R8051:Tyrp1	UTSW	4	80837660	missense	probably damaging	1.00
R8233:Tyrp1	UTSW	4	80850953	missense	unknown
R8326:Tyrp1	UTSW	4	80850684	missense	probably benign	0.06
R8831:Tyrp1	UTSW	4	80835162	missense	probably damaging	1.00
R8907:Tyrp1	UTSW	4	80837561	missense	probably damaging	1.00
R8998:Tyrp1	UTSW	4	80844857	missense	probably damaging	1.00
R8999:Tyrp1	UTSW	4	80844857	missense	probably damaging	1.00
R9732:Tyrp1	UTSW	4	80840693	missense	possibly damaging	0.52
R9751:Tyrp1	UTSW	4	80840775	missense	probably null	0.00
Z1176:Tyrp1	UTSW	4	80844889	nonsense	probably null
Z1177:Tyrp1	UTSW	4	80849817	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CACTCACTGACTCCTTAGCAG -3'
(R):5'- TCTGAAGAGGGACCTTACAGGC -3'

Sequencing Primer
(F):5'- TCACTGACTCCTTAGCAGGTAGAG -3'
(R):5'- CTTACAGGCAACACAGTCATTTATAG -3'

Posted On

2020-01-23