Mutagenetix > Incidental Mutation

Incidental Mutation 'R8001:Pole'

616355

Institutional Source

Beutler Lab

Gene Symbol

Pole

Ensembl Gene

ENSMUSG00000007080

Gene Name

polymerase (DNA directed), epsilon

Synonyms

pol-epsilon

MMRRC Submission

046041-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110286306-110337474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 110312734 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1127 (I1127F)

Ref Sequence

ENSEMBL: ENSMUSP00000007296 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007296]

AlphaFold

Q9WVF7

Predicted Effect

probably damaging
Transcript: ENSMUST00000007296
AA Change: I1127F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: I1127F

Domain	Start	End	E-Value	Type
POLBc	267	870	9.42e-97	SMART
Blast:POLBc	903	970	1e-28	BLAST
Blast:POLBc	1014	1073	2e-22	BLAST
Blast:POLBc	1195	1266	7e-21	BLAST
low complexity region	1275	1294	N/A	INTRINSIC
Blast:DUF1744	1401	1430	2e-7	BLAST
DUF1744	1524	1924	1.9e-236	SMART
coiled coil region	1936	1963	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	A	G	1: 93,154,599	L266P	probably damaging	Het
Acr	A	G	15: 89,573,962	Y282C	probably damaging	Het
Alkbh4	A	G	5: 136,140,269	R136G	probably damaging	Het
Bptf	C	A	11: 107,047,340	E2*	probably null	Het
Cse1l	T	A	2: 166,939,913	F659Y	probably damaging	Het
Ctrc	A	T	4: 141,840,360	L144Q	probably damaging	Het
Elmo1	A	G	13: 20,286,732	I265V	probably benign	Het
Erich3	T	C	3: 154,713,916	S19P	probably benign	Het
Hmcn1	A	T	1: 150,664,878	C2893*	probably null	Het
Hnrnpll	G	A	17: 80,038,723	Q370*	probably null	Het
Itpkb	T	C	1: 180,332,494	S62P	probably damaging	Het
Lig3	T	A	11: 82,792,076	C501S	probably benign	Het
Nrxn1	C	T	17: 91,088,536	R64H	possibly damaging	Het
Ogfod2	T	G	5: 124,114,883	C319G	probably damaging	Het
Olfr1474	A	G	19: 13,471,422	I109V	probably benign	Het
Olfr201	T	C	16: 59,269,109	N186S	probably benign	Het
Olfr555	A	T	7: 102,659,034	D71V	probably damaging	Het
Olfr827	A	G	10: 130,210,860	V90A	probably benign	Het
Pabpc6	C	A	17: 9,669,373	R83L	probably damaging	Het
Pcdhgb2	A	T	18: 37,690,634	Q226L	probably benign	Het
Psg22	A	T	7: 18,719,746	Q161L	possibly damaging	Het
Slc17a7	A	T	7: 45,168,788	T46S	probably benign	Het
Smad4	A	G	18: 73,641,810	S473P	probably damaging	Het
Snap47	T	A	11: 59,438,354	T41S	probably benign	Het
Snx21	T	C	2: 164,786,737	L100P	probably benign	Het
Stc1	T	A	14: 69,038,395	N212K	probably benign	Het
Stk32a	A	T	18: 43,315,144	N396I	possibly damaging	Het
Stox2	G	A	8: 47,186,477	P894L	probably benign	Het
Trav16d-dv11	A	G	14: 53,047,287	M1V	probably null	Het
Trim33	T	C	3: 103,311,515		probably null	Het
Tyrp1	T	C	4: 80,840,670	V260A	probably benign	Het
Ush2a	T	C	1: 188,911,064	Y4208H	probably damaging	Het
Vmn1r25	T	A	6: 57,979,080	K75*	probably null	Het
Vmn2r117	T	A	17: 23,479,407	N64I	possibly damaging	Het
Wdfy4	C	T	14: 32,973,535		probably null	Het
Wnt8a	A	T	18: 34,545,516	I128F	probably damaging	Het
Zc3h7b	C	A	15: 81,779,260	Y484*	probably null	Het
Zfp619	A	G	7: 39,535,221	K225R	probably benign	Het

Other mutations in Pole

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Pole	APN	5	110303565	splice site	probably benign
IGL00475:Pole	APN	5	110291096	nonsense	probably null
IGL00837:Pole	APN	5	110302009	missense	possibly damaging	0.91
IGL00976:Pole	APN	5	110323572	missense	probably benign	0.00
IGL01081:Pole	APN	5	110337240	missense	possibly damaging	0.92
IGL01503:Pole	APN	5	110303884	missense	probably damaging	1.00
IGL01640:Pole	APN	5	110298266	missense	probably null	0.08
IGL01987:Pole	APN	5	110337232	missense	probably benign	0.01
IGL02429:Pole	APN	5	110299800	missense	probably benign
IGL02733:Pole	APN	5	110312728	splice site	probably benign
IGL03102:Pole	APN	5	110297073	missense	probably damaging	1.00
IGL03157:Pole	APN	5	110293753	missense	probably benign
IGL03186:Pole	APN	5	110299920	critical splice donor site	probably null
IGL03271:Pole	APN	5	110318319	missense	probably benign
IGL03351:Pole	APN	5	110301998	splice site	probably benign
IGL03408:Pole	APN	5	110294560	missense	probably damaging	1.00
IGL03410:Pole	APN	5	110324559	missense	probably benign
ANU74:Pole	UTSW	5	110289370	missense	probably benign	0.44
PIT4495001:Pole	UTSW	5	110303914	missense	probably damaging	1.00
R0053:Pole	UTSW	5	110293340	missense	probably damaging	1.00
R0053:Pole	UTSW	5	110293340	missense	probably damaging	1.00
R0124:Pole	UTSW	5	110303992	missense	probably damaging	0.96
R0145:Pole	UTSW	5	110324425	missense	probably damaging	0.99
R0523:Pole	UTSW	5	110303593	missense	probably damaging	0.96
R0590:Pole	UTSW	5	110317926	missense	probably benign
R0625:Pole	UTSW	5	110325550	missense	possibly damaging	0.50
R0707:Pole	UTSW	5	110298988	missense	probably damaging	1.00
R1160:Pole	UTSW	5	110295253	missense	possibly damaging	0.85
R1320:Pole	UTSW	5	110309129	frame shift	probably null
R1384:Pole	UTSW	5	110323664	missense	possibly damaging	0.81
R1626:Pole	UTSW	5	110293369	missense	probably benign	0.25
R1643:Pole	UTSW	5	110317845	missense	probably damaging	1.00
R1655:Pole	UTSW	5	110335922	missense	probably damaging	1.00
R1668:Pole	UTSW	5	110297369	missense	probably damaging	1.00
R1783:Pole	UTSW	5	110297430	missense	probably damaging	1.00
R1843:Pole	UTSW	5	110330835	critical splice donor site	probably null
R1853:Pole	UTSW	5	110306853	missense	possibly damaging	0.95
R1867:Pole	UTSW	5	110334197	missense	probably benign	0.08
R1874:Pole	UTSW	5	110323664	missense	possibly damaging	0.81
R1891:Pole	UTSW	5	110332542	missense	probably damaging	1.00
R1928:Pole	UTSW	5	110327778	missense	probably benign
R2073:Pole	UTSW	5	110325551	missense	probably damaging	0.99
R2341:Pole	UTSW	5	110330963	missense	possibly damaging	0.67
R2448:Pole	UTSW	5	110297092	missense	probably damaging	1.00
R2504:Pole	UTSW	5	110290502	splice site	probably null
R3053:Pole	UTSW	5	110289795	missense	probably damaging	1.00
R3892:Pole	UTSW	5	110336439	missense	probably damaging	1.00
R3964:Pole	UTSW	5	110312782	missense	probably damaging	1.00
R3965:Pole	UTSW	5	110312782	missense	probably damaging	1.00
R4374:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4376:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4377:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4520:Pole	UTSW	5	110297924	missense	probably damaging	1.00
R4670:Pole	UTSW	5	110306387	missense	probably benign	0.01
R4778:Pole	UTSW	5	110330832	missense	probably benign	0.00
R4887:Pole	UTSW	5	110324753	missense	probably damaging	0.99
R4898:Pole	UTSW	5	110290224	critical splice acceptor site	probably null
R5184:Pole	UTSW	5	110294934	missense	possibly damaging	0.91
R5359:Pole	UTSW	5	110332488	missense	probably benign	0.03
R5483:Pole	UTSW	5	110294568	missense	probably damaging	1.00
R5529:Pole	UTSW	5	110332466	missense	probably benign	0.20
R5576:Pole	UTSW	5	110312065	nonsense	probably null
R5817:Pole	UTSW	5	110312972	missense	probably damaging	1.00
R5877:Pole	UTSW	5	110332463	missense	probably benign
R5956:Pole	UTSW	5	110337287	unclassified	probably benign
R5990:Pole	UTSW	5	110302144	missense	probably damaging	1.00
R6019:Pole	UTSW	5	110324514	missense	probably benign	0.01
R6019:Pole	UTSW	5	110324515	missense	probably benign	0.01
R6093:Pole	UTSW	5	110312090	missense	probably benign	0.01
R6376:Pole	UTSW	5	110336374	missense	probably damaging	0.99
R6494:Pole	UTSW	5	110324722	missense	possibly damaging	0.86
R6535:Pole	UTSW	5	110324807	missense	probably damaging	1.00
R6723:Pole	UTSW	5	110323616	missense	probably benign	0.11
R6757:Pole	UTSW	5	110303610	missense	probably damaging	1.00
R6930:Pole	UTSW	5	110293290	missense	probably benign	0.01
R6988:Pole	UTSW	5	110329583	missense	probably damaging	0.97
R6992:Pole	UTSW	5	110332499	missense	probably damaging	0.99
R7067:Pole	UTSW	5	110334218	missense	probably damaging	1.00
R7097:Pole	UTSW	5	110325102	splice site	probably null
R7122:Pole	UTSW	5	110325102	splice site	probably null
R7202:Pole	UTSW	5	110297107	missense	possibly damaging	0.94
R7340:Pole	UTSW	5	110334464	missense	probably benign	0.06
R7345:Pole	UTSW	5	110303903	missense	possibly damaging	0.82
R7509:Pole	UTSW	5	110330705	start gained	probably benign
R7557:Pole	UTSW	5	110312994	missense	probably damaging	1.00
R7740:Pole	UTSW	5	110331041	missense	probably benign	0.00
R7792:Pole	UTSW	5	110297466	splice site	probably null
R7832:Pole	UTSW	5	110317797	missense	probably benign	0.00
R7849:Pole	UTSW	5	110332548	missense	probably benign	0.04
R7852:Pole	UTSW	5	110306829	missense	probably damaging	1.00
R7960:Pole	UTSW	5	110289861	missense	possibly damaging	0.81
R8266:Pole	UTSW	5	110294920	missense	probably damaging	1.00
R8510:Pole	UTSW	5	110334446	missense	probably damaging	0.99
R8793:Pole	UTSW	5	110297748	missense	probably damaging	1.00
R8835:Pole	UTSW	5	110306909	missense	probably damaging	1.00
R8863:Pole	UTSW	5	110289367	missense	possibly damaging	0.94
R8929:Pole	UTSW	5	110297788	missense	probably damaging	0.98
R8968:Pole	UTSW	5	110312083	missense	possibly damaging	0.78
R8992:Pole	UTSW	5	110323622	missense	possibly damaging	0.88
R9018:Pole	UTSW	5	110289809	missense	probably benign	0.37
R9177:Pole	UTSW	5	110332422	missense	probably benign	0.04
R9250:Pole	UTSW	5	110299821	missense	possibly damaging	0.88
R9262:Pole	UTSW	5	110325556	missense	probably damaging	0.99
R9262:Pole	UTSW	5	110325557	missense	probably damaging	1.00
R9367:Pole	UTSW	5	110297089	missense	probably damaging	0.99
R9383:Pole	UTSW	5	110291026	missense	possibly damaging	0.61
R9626:Pole	UTSW	5	110312093	missense	possibly damaging	0.68
R9676:Pole	UTSW	5	110295565	missense	probably benign	0.00
R9720:Pole	UTSW	5	110337043	missense	probably benign	0.01
R9787:Pole	UTSW	5	110318000	critical splice donor site	probably null
R9794:Pole	UTSW	5	110318335	missense	probably benign	0.01
X0064:Pole	UTSW	5	110317904	nonsense	probably null
Y5377:Pole	UTSW	5	110294891	critical splice acceptor site	probably null
Y5380:Pole	UTSW	5	110294891	critical splice acceptor site	probably null
Z1088:Pole	UTSW	5	110327865	missense	possibly damaging	0.66
Z1177:Pole	UTSW	5	110297009	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCTAGGGCATCATGAAGCC -3'
(R):5'- GACACGTGGAACTGGGTTCTTC -3'

Sequencing Primer
(F):5'- TCTAGGGCATCATGAAGCCCTTAG -3'
(R):5'- ACTGGGTTCTTCACCTAAGAGAG -3'

Posted On

2020-01-23