Incidental Mutation 'R8001:Ogfod2'
ID616356
Institutional Source Beutler Lab
Gene Symbol Ogfod2
Ensembl Gene ENSMUSG00000023707
Gene Name2-oxoglutarate and iron-dependent oxygenase domain containing 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R8001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location124112297-124115483 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 124114883 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 319 (C319G)
Ref Sequence ENSEMBL: ENSMUSP00000024470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024470] [ENSMUST00000031351] [ENSMUST00000086123] [ENSMUST00000119269] [ENSMUST00000122394] [ENSMUST00000145667] [ENSMUST00000149835] [ENSMUST00000161273] [ENSMUST00000161938] [ENSMUST00000162812] [ENSMUST00000196401] [ENSMUST00000196627] [ENSMUST00000198505] [ENSMUST00000198770]
Predicted Effect probably damaging
Transcript: ENSMUST00000024470
AA Change: C319G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024470
Gene: ENSMUSG00000023707
AA Change: C319G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:P4Hc 42 100 2e-6 BLAST
low complexity region 102 112 N/A INTRINSIC
P4Hc 136 307 7.91e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031351
SMART Domains Protein: ENSMUSP00000031351
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
Pfam:SR-25 7 227 2.7e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086123
SMART Domains Protein: ENSMUSP00000083292
Gene: ENSMUSG00000029406

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119269
SMART Domains Protein: ENSMUSP00000112701
Gene: ENSMUSG00000023707

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:P4Hc 42 133 1e-22 BLAST
Blast:P4Hc 136 175 1e-20 BLAST
low complexity region 176 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122394
SMART Domains Protein: ENSMUSP00000112506
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
Pfam:SR-25 2 199 6.3e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145667
SMART Domains Protein: ENSMUSP00000122377
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
Pfam:SR-25 19 227 3e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149835
SMART Domains Protein: ENSMUSP00000116269
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
low complexity region 5 32 N/A INTRINSIC
SCOP:d1l9ha_ 58 84 7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161273
SMART Domains Protein: ENSMUSP00000124292
Gene: ENSMUSG00000029406

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-129 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 945 7.5e-100 SMART
LNS2 1090 1221 3.1e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161938
SMART Domains Protein: ENSMUSP00000124111
Gene: ENSMUSG00000029406

DomainStartEndE-ValueType
Pfam:IP_trans 1 251 7.5e-116 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 949 8.37e-104 SMART
LNS2 1094 1225 3.22e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162812
SMART Domains Protein: ENSMUSP00000124740
Gene: ENSMUSG00000029406

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196401
SMART Domains Protein: ENSMUSP00000142496
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
low complexity region 29 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196627
SMART Domains Protein: ENSMUSP00000143698
Gene: ENSMUSG00000023707

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:P4Hc 42 133 1e-23 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198505
SMART Domains Protein: ENSMUSP00000142965
Gene: ENSMUSG00000023707

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198770
SMART Domains Protein: ENSMUSP00000143318
Gene: ENSMUSG00000023707

DomainStartEndE-ValueType
Blast:P4Hc 11 102 7e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199457
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A G 1: 93,154,599 L266P probably damaging Het
Acr A G 15: 89,573,962 Y282C probably damaging Het
Alkbh4 A G 5: 136,140,269 R136G probably damaging Het
Bptf C A 11: 107,047,340 E2* probably null Het
Cse1l T A 2: 166,939,913 F659Y probably damaging Het
Ctrc A T 4: 141,840,360 L144Q probably damaging Het
Elmo1 A G 13: 20,286,732 I265V probably benign Het
Erich3 T C 3: 154,713,916 S19P probably benign Het
Hmcn1 A T 1: 150,664,878 C2893* probably null Het
Hnrnpll G A 17: 80,038,723 Q370* probably null Het
Itpkb T C 1: 180,332,494 S62P probably damaging Het
Lig3 T A 11: 82,792,076 C501S probably benign Het
Nrxn1 C T 17: 91,088,536 R64H possibly damaging Het
Olfr1474 A G 19: 13,471,422 I109V probably benign Het
Olfr201 T C 16: 59,269,109 N186S probably benign Het
Olfr555 A T 7: 102,659,034 D71V probably damaging Het
Olfr827 A G 10: 130,210,860 V90A probably benign Het
Pabpc6 C A 17: 9,669,373 R83L probably damaging Het
Pcdhgb2 A T 18: 37,690,634 Q226L probably benign Het
Pole A T 5: 110,312,734 I1127F probably damaging Het
Psg22 A T 7: 18,719,746 Q161L possibly damaging Het
Slc17a7 A T 7: 45,168,788 T46S probably benign Het
Smad4 A G 18: 73,641,810 S473P probably damaging Het
Snap47 T A 11: 59,438,354 T41S probably benign Het
Snx21 T C 2: 164,786,737 L100P probably benign Het
Stc1 T A 14: 69,038,395 N212K probably benign Het
Stk32a A T 18: 43,315,144 N396I possibly damaging Het
Stox2 G A 8: 47,186,477 P894L probably benign Het
Trav16d-dv11 A G 14: 53,047,287 M1V probably null Het
Trim33 T C 3: 103,311,515 probably null Het
Tyrp1 T C 4: 80,840,670 V260A probably benign Het
Ush2a T C 1: 188,911,064 Y4208H probably damaging Het
Vmn1r25 T A 6: 57,979,080 K75* probably null Het
Vmn2r117 T A 17: 23,479,407 N64I possibly damaging Het
Wdfy4 C T 14: 32,973,535 probably null Het
Wnt8a A T 18: 34,545,516 I128F probably damaging Het
Zc3h7b C A 15: 81,779,260 Y484* probably null Het
Zfp619 A G 7: 39,535,221 K225R probably benign Het
Other mutations in Ogfod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02305:Ogfod2 APN 5 124112847 critical splice donor site probably null
IGL03304:Ogfod2 APN 5 124112823 missense probably damaging 0.99
R0018:Ogfod2 UTSW 5 124114525 unclassified probably benign
R0681:Ogfod2 UTSW 5 124112844 missense probably null 1.00
R0751:Ogfod2 UTSW 5 124113476 unclassified probably benign
R1744:Ogfod2 UTSW 5 124114156 unclassified probably null
R1800:Ogfod2 UTSW 5 124114956 missense probably damaging 1.00
R2211:Ogfod2 UTSW 5 124112780 splice site probably null
R3977:Ogfod2 UTSW 5 124113209 splice site probably null
R4346:Ogfod2 UTSW 5 124113294 missense probably damaging 1.00
R4508:Ogfod2 UTSW 5 124113254 nonsense probably null
R4537:Ogfod2 UTSW 5 124114528 unclassified probably benign
R5795:Ogfod2 UTSW 5 124114761 missense probably damaging 1.00
R6647:Ogfod2 UTSW 5 124114803 missense possibly damaging 0.95
R7101:Ogfod2 UTSW 5 124114495 missense unknown
R8139:Ogfod2 UTSW 5 124113475 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CTGAACCATAGCCTCTGCAG -3'
(R):5'- ACCCAAAAGTCTGCGTGTCC -3'

Sequencing Primer
(F):5'- TCTGCAGGCACCCGCAG -3'
(R):5'- TCCTTTTGACCCAAGGAGTG -3'
Posted On2020-01-23