Incidental Mutation 'R8001:Alkbh4'
ID616357
Institutional Source Beutler Lab
Gene Symbol Alkbh4
Ensembl Gene ENSMUSG00000039754
Gene NamealkB homolog 4, lysine demethylase
Synonyms2010004B12Rik, Abj4
Accession Numbers
Is this an essential gene? Not available question?
Stock #R8001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location136136146-136141615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136140269 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 136 (R136G)
Ref Sequence ENSEMBL: ENSMUSP00000040403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006301] [ENSMUST00000041100] [ENSMUST00000100568] [ENSMUST00000125923] [ENSMUST00000136634] [ENSMUST00000143229] [ENSMUST00000150406]
Predicted Effect probably benign
Transcript: ENSMUST00000006301
SMART Domains Protein: ENSMUSP00000006301
Gene: ENSMUSG00000029703

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
LRR_TYP 46 69 3.16e-3 SMART
LRR 90 113 1.58e2 SMART
WD40 271 327 6.36e1 SMART
Blast:WD40 330 380 2e-12 BLAST
WD40 383 423 1.49e-7 SMART
WD40 434 473 2.28e2 SMART
Blast:WD40 484 527 6e-15 BLAST
WD40 542 583 1.42e2 SMART
low complexity region 591 602 N/A INTRINSIC
Blast:WD40 603 646 8e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000041100
AA Change: R136G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040403
Gene: ENSMUSG00000039754
AA Change: R136G

DomainStartEndE-ValueType
low complexity region 252 263 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100568
AA Change: R51G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098134
Gene: ENSMUSG00000039754
AA Change: R51G

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy 61 186 2.1e-8 PFAM
low complexity region 196 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125923
Predicted Effect probably damaging
Transcript: ENSMUST00000136634
AA Change: R51G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000143229
Predicted Effect probably benign
Transcript: ENSMUST00000150406
SMART Domains Protein: ENSMUSP00000121513
Gene: ENSMUSG00000029703

DomainStartEndE-ValueType
LRR_TYP 55 78 3.16e-3 SMART
LRR 99 122 1.58e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation exhibit lethality prior to weaning. Mice homozygous for a floxed allele activated in mouse embryonic fibroblasts exhibit decreased migration and impaired cytokinesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A G 1: 93,154,599 L266P probably damaging Het
Acr A G 15: 89,573,962 Y282C probably damaging Het
Bptf C A 11: 107,047,340 E2* probably null Het
Cse1l T A 2: 166,939,913 F659Y probably damaging Het
Ctrc A T 4: 141,840,360 L144Q probably damaging Het
Elmo1 A G 13: 20,286,732 I265V probably benign Het
Erich3 T C 3: 154,713,916 S19P probably benign Het
Hmcn1 A T 1: 150,664,878 C2893* probably null Het
Hnrnpll G A 17: 80,038,723 Q370* probably null Het
Itpkb T C 1: 180,332,494 S62P probably damaging Het
Lig3 T A 11: 82,792,076 C501S probably benign Het
Nrxn1 C T 17: 91,088,536 R64H possibly damaging Het
Ogfod2 T G 5: 124,114,883 C319G probably damaging Het
Olfr1474 A G 19: 13,471,422 I109V probably benign Het
Olfr201 T C 16: 59,269,109 N186S probably benign Het
Olfr555 A T 7: 102,659,034 D71V probably damaging Het
Olfr827 A G 10: 130,210,860 V90A probably benign Het
Pabpc6 C A 17: 9,669,373 R83L probably damaging Het
Pcdhgb2 A T 18: 37,690,634 Q226L probably benign Het
Pole A T 5: 110,312,734 I1127F probably damaging Het
Psg22 A T 7: 18,719,746 Q161L possibly damaging Het
Slc17a7 A T 7: 45,168,788 T46S probably benign Het
Smad4 A G 18: 73,641,810 S473P probably damaging Het
Snap47 T A 11: 59,438,354 T41S probably benign Het
Snx21 T C 2: 164,786,737 L100P probably benign Het
Stc1 T A 14: 69,038,395 N212K probably benign Het
Stk32a A T 18: 43,315,144 N396I possibly damaging Het
Stox2 G A 8: 47,186,477 P894L probably benign Het
Trav16d-dv11 A G 14: 53,047,287 M1V probably null Het
Trim33 T C 3: 103,311,515 probably null Het
Tyrp1 T C 4: 80,840,670 V260A probably benign Het
Ush2a T C 1: 188,911,064 Y4208H probably damaging Het
Vmn1r25 T A 6: 57,979,080 K75* probably null Het
Vmn2r117 T A 17: 23,479,407 N64I possibly damaging Het
Wdfy4 C T 14: 32,973,535 probably null Het
Wnt8a A T 18: 34,545,516 I128F probably damaging Het
Zc3h7b C A 15: 81,779,260 Y484* probably null Het
Zfp619 A G 7: 39,535,221 K225R probably benign Het
Predicted Primers PCR Primer
(F):5'- TTAAGCTGGGCCACTTCTCC -3'
(R):5'- CTCAAAAGCATCAGGTCTGACG -3'

Sequencing Primer
(F):5'- CTTCCTGTCTCCACTGTAGGACTATG -3'
(R):5'- AGGGGCCTCTGGAGACATG -3'
Posted On2020-01-23