Incidental Mutation 'R8001:Psg22'
ID 616359
Institutional Source Beutler Lab
Gene Symbol Psg22
Ensembl Gene ENSMUSG00000044903
Gene Name pregnancy-specific beta-1-glycoprotein 22
Synonyms cea9
MMRRC Submission 046041-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R8001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18452015-18461173 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18453671 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 161 (Q161L)
Ref Sequence ENSEMBL: ENSMUSP00000104121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051973] [ENSMUST00000108481] [ENSMUST00000208221]
AlphaFold Q810J1
Predicted Effect possibly damaging
Transcript: ENSMUST00000051973
AA Change: Q122L

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050633
Gene: ENSMUSG00000044903
AA Change: Q122L

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
IG 40 141 7.59e-4 SMART
IG 160 261 1.13e-2 SMART
IG 280 381 3.74e-3 SMART
IGc2 397 461 7.35e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108481
AA Change: Q161L

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104121
Gene: ENSMUSG00000044903
AA Change: Q161L

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
IG 79 180 7.59e-4 SMART
IG 199 300 1.13e-2 SMART
IG 319 420 3.74e-3 SMART
IGc2 436 500 7.35e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000208221
AA Change: Q122L

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acr A G 15: 89,458,165 (GRCm39) Y282C probably damaging Het
Alkbh4 A G 5: 136,169,123 (GRCm39) R136G probably damaging Het
Bptf C A 11: 106,938,166 (GRCm39) E2* probably null Het
Cse1l T A 2: 166,781,833 (GRCm39) F659Y probably damaging Het
Ctrc A T 4: 141,567,671 (GRCm39) L144Q probably damaging Het
Elmo1 A G 13: 20,470,902 (GRCm39) I265V probably benign Het
Erich3 T C 3: 154,419,553 (GRCm39) S19P probably benign Het
Hmcn1 A T 1: 150,540,629 (GRCm39) C2893* probably null Het
Hnrnpll G A 17: 80,346,152 (GRCm39) Q370* probably null Het
Itpkb T C 1: 180,160,059 (GRCm39) S62P probably damaging Het
Lig3 T A 11: 82,682,902 (GRCm39) C501S probably benign Het
Mab21l4 A G 1: 93,082,321 (GRCm39) L266P probably damaging Het
Nrxn1 C T 17: 91,395,964 (GRCm39) R64H possibly damaging Het
Ogfod2 T G 5: 124,252,946 (GRCm39) C319G probably damaging Het
Or51h1 A T 7: 102,308,241 (GRCm39) D71V probably damaging Het
Or5ac19 T C 16: 59,089,472 (GRCm39) N186S probably benign Het
Or5b118 A G 19: 13,448,786 (GRCm39) I109V probably benign Het
Or9k7 A G 10: 130,046,729 (GRCm39) V90A probably benign Het
Pabpc6 C A 17: 9,888,302 (GRCm39) R83L probably damaging Het
Pcdhgb2 A T 18: 37,823,687 (GRCm39) Q226L probably benign Het
Pole A T 5: 110,460,600 (GRCm39) I1127F probably damaging Het
Slc17a7 A T 7: 44,818,212 (GRCm39) T46S probably benign Het
Smad4 A G 18: 73,774,881 (GRCm39) S473P probably damaging Het
Snap47 T A 11: 59,329,180 (GRCm39) T41S probably benign Het
Snx21 T C 2: 164,628,657 (GRCm39) L100P probably benign Het
Stc1 T A 14: 69,275,844 (GRCm39) N212K probably benign Het
Stk32a A T 18: 43,448,209 (GRCm39) N396I possibly damaging Het
Stox2 G A 8: 47,639,512 (GRCm39) P894L probably benign Het
Trav16d-dv11 A G 14: 53,284,744 (GRCm39) M1V probably null Het
Trim33 T C 3: 103,218,831 (GRCm39) probably null Het
Tyrp1 T C 4: 80,758,907 (GRCm39) V260A probably benign Het
Ush2a T C 1: 188,643,261 (GRCm39) Y4208H probably damaging Het
Vmn1r25 T A 6: 57,956,065 (GRCm39) K75* probably null Het
Vmn2r117 T A 17: 23,698,381 (GRCm39) N64I possibly damaging Het
Wdfy4 C T 14: 32,695,492 (GRCm39) probably null Het
Wnt8a A T 18: 34,678,569 (GRCm39) I128F probably damaging Het
Zc3h7b C A 15: 81,663,461 (GRCm39) Y484* probably null Het
Zfp619 A G 7: 39,184,645 (GRCm39) K225R probably benign Het
Other mutations in Psg22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Psg22 APN 7 18,452,200 (GRCm39) missense probably benign 0.00
IGL00839:Psg22 APN 7 18,456,893 (GRCm39) missense probably benign 0.01
IGL00898:Psg22 APN 7 18,458,392 (GRCm39) missense probably damaging 1.00
IGL02262:Psg22 APN 7 18,458,496 (GRCm39) missense probably damaging 0.98
IGL02678:Psg22 APN 7 18,453,418 (GRCm39) missense probably damaging 0.99
IGL02749:Psg22 APN 7 18,456,944 (GRCm39) missense possibly damaging 0.50
IGL02928:Psg22 APN 7 18,453,458 (GRCm39) missense probably damaging 0.98
IGL02977:Psg22 APN 7 18,453,524 (GRCm39) missense probably benign 0.20
R0470:Psg22 UTSW 7 18,453,589 (GRCm39) missense probably damaging 0.99
R1902:Psg22 UTSW 7 18,458,363 (GRCm39) nonsense probably null
R1935:Psg22 UTSW 7 18,453,635 (GRCm39) missense probably damaging 0.99
R1936:Psg22 UTSW 7 18,453,635 (GRCm39) missense probably damaging 0.99
R2013:Psg22 UTSW 7 18,453,560 (GRCm39) missense possibly damaging 0.93
R2278:Psg22 UTSW 7 18,460,762 (GRCm39) missense possibly damaging 0.80
R4258:Psg22 UTSW 7 18,458,554 (GRCm39) missense probably damaging 1.00
R5029:Psg22 UTSW 7 18,453,662 (GRCm39) missense probably damaging 1.00
R5885:Psg22 UTSW 7 18,452,257 (GRCm39) missense probably damaging 0.98
R6084:Psg22 UTSW 7 18,453,705 (GRCm39) missense probably benign 0.01
R6143:Psg22 UTSW 7 18,456,723 (GRCm39) missense probably benign 0.03
R6209:Psg22 UTSW 7 18,453,599 (GRCm39) missense probably damaging 1.00
R7017:Psg22 UTSW 7 18,458,366 (GRCm39) missense probably benign 0.01
R7337:Psg22 UTSW 7 18,453,499 (GRCm39) missense probably benign 0.20
R7417:Psg22 UTSW 7 18,456,891 (GRCm39) missense probably damaging 1.00
R7460:Psg22 UTSW 7 18,458,329 (GRCm39) missense probably benign 0.03
R7570:Psg22 UTSW 7 18,456,660 (GRCm39) missense possibly damaging 0.95
R7650:Psg22 UTSW 7 18,460,684 (GRCm39) missense possibly damaging 0.66
R7711:Psg22 UTSW 7 18,452,267 (GRCm39) critical splice donor site probably null
R7991:Psg22 UTSW 7 18,460,861 (GRCm39) missense probably damaging 1.00
R8003:Psg22 UTSW 7 18,458,350 (GRCm39) missense probably damaging 1.00
R8066:Psg22 UTSW 7 18,452,218 (GRCm39) missense possibly damaging 0.88
R8113:Psg22 UTSW 7 18,456,987 (GRCm39) missense probably benign 0.00
R9136:Psg22 UTSW 7 18,460,811 (GRCm39) missense probably damaging 1.00
R9148:Psg22 UTSW 7 18,460,682 (GRCm39) missense probably benign 0.09
R9152:Psg22 UTSW 7 18,460,646 (GRCm39) missense probably damaging 0.97
R9344:Psg22 UTSW 7 18,460,816 (GRCm39) missense possibly damaging 0.69
R9666:Psg22 UTSW 7 18,458,248 (GRCm39) missense probably benign
R9801:Psg22 UTSW 7 18,456,899 (GRCm39) missense probably benign 0.11
X0064:Psg22 UTSW 7 18,452,106 (GRCm39) missense probably benign 0.01
Z1177:Psg22 UTSW 7 18,453,602 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCTGCCAGAGAATCTTCGAGTC -3'
(R):5'- GACATTGTTCTCCACCATGTGTG -3'

Sequencing Primer
(F):5'- GCCAGAGAATCTTCGAGTCTTTGTC -3'
(R):5'- TGCTCAAGCCCCAATATGGAG -3'
Posted On 2020-01-23