Incidental Mutation 'R8001:Slc17a7'
ID616361
Institutional Source Beutler Lab
Gene Symbol Slc17a7
Ensembl Gene ENSMUSG00000070570
Gene Namesolute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7
Synonyms2900052E22Rik, Vglut1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.410) question?
Stock #R8001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45163949-45176142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45168788 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 46 (T46S)
Ref Sequence ENSEMBL: ENSMUSP00000082489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085374] [ENSMUST00000209634]
Predicted Effect probably benign
Transcript: ENSMUST00000085374
AA Change: T46S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000082489
Gene: ENSMUSG00000070570
AA Change: T46S

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:MFS_1 68 453 9.3e-49 PFAM
transmembrane domain 468 490 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
low complexity region 550 556 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209634
AA Change: T46S

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a vesicle-bound, sodium-dependent phosphate transporter that is specifically expressed in the neuron-rich regions of the brain. It is preferentially associated with the membranes of synaptic vesicles and functions in glutamate transport. The protein shares 82% identity with the differentiation-associated Na-dependent inorganic phosphate cotransporter and they appear to form a distinct class within the Na+/Pi cotransporter family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are small and fail to thrive by 3-4 weeks of age. Abnormal excitatory post synaptic potential and currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A G 1: 93,154,599 L266P probably damaging Het
Acr A G 15: 89,573,962 Y282C probably damaging Het
Alkbh4 A G 5: 136,140,269 R136G probably damaging Het
Bptf C A 11: 107,047,340 E2* probably null Het
Cse1l T A 2: 166,939,913 F659Y probably damaging Het
Ctrc A T 4: 141,840,360 L144Q probably damaging Het
Elmo1 A G 13: 20,286,732 I265V probably benign Het
Erich3 T C 3: 154,713,916 S19P probably benign Het
Hmcn1 A T 1: 150,664,878 C2893* probably null Het
Hnrnpll G A 17: 80,038,723 Q370* probably null Het
Itpkb T C 1: 180,332,494 S62P probably damaging Het
Lig3 T A 11: 82,792,076 C501S probably benign Het
Nrxn1 C T 17: 91,088,536 R64H possibly damaging Het
Ogfod2 T G 5: 124,114,883 C319G probably damaging Het
Olfr1474 A G 19: 13,471,422 I109V probably benign Het
Olfr201 T C 16: 59,269,109 N186S probably benign Het
Olfr555 A T 7: 102,659,034 D71V probably damaging Het
Olfr827 A G 10: 130,210,860 V90A probably benign Het
Pabpc6 C A 17: 9,669,373 R83L probably damaging Het
Pcdhgb2 A T 18: 37,690,634 Q226L probably benign Het
Pole A T 5: 110,312,734 I1127F probably damaging Het
Psg22 A T 7: 18,719,746 Q161L possibly damaging Het
Smad4 A G 18: 73,641,810 S473P probably damaging Het
Snap47 T A 11: 59,438,354 T41S probably benign Het
Snx21 T C 2: 164,786,737 L100P probably benign Het
Stc1 T A 14: 69,038,395 N212K probably benign Het
Stk32a A T 18: 43,315,144 N396I possibly damaging Het
Stox2 G A 8: 47,186,477 P894L probably benign Het
Trav16d-dv11 A G 14: 53,047,287 M1V probably null Het
Trim33 T C 3: 103,311,515 probably null Het
Tyrp1 T C 4: 80,840,670 V260A probably benign Het
Ush2a T C 1: 188,911,064 Y4208H probably damaging Het
Vmn1r25 T A 6: 57,979,080 K75* probably null Het
Vmn2r117 T A 17: 23,479,407 N64I possibly damaging Het
Wdfy4 C T 14: 32,973,535 probably null Het
Wnt8a A T 18: 34,545,516 I128F probably damaging Het
Zc3h7b C A 15: 81,779,260 Y484* probably null Het
Zfp619 A G 7: 39,535,221 K225R probably benign Het
Other mutations in Slc17a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02208:Slc17a7 APN 7 45170943 missense probably damaging 1.00
IGL02536:Slc17a7 APN 7 45170946 missense probably damaging 1.00
IGL03057:Slc17a7 APN 7 45170939 missense probably damaging 0.98
R0081:Slc17a7 UTSW 7 45174947 missense probably benign 0.00
R1188:Slc17a7 UTSW 7 45169887 missense possibly damaging 0.80
R1713:Slc17a7 UTSW 7 45170304 missense probably benign 0.05
R2512:Slc17a7 UTSW 7 45168864 missense probably damaging 1.00
R3915:Slc17a7 UTSW 7 45168720 missense probably damaging 0.97
R3972:Slc17a7 UTSW 7 45169910 missense possibly damaging 0.46
R4727:Slc17a7 UTSW 7 45172934 missense possibly damaging 0.64
R4761:Slc17a7 UTSW 7 45170984 missense probably benign
R6047:Slc17a7 UTSW 7 45173406 missense probably benign 0.07
R6113:Slc17a7 UTSW 7 45174751 missense possibly damaging 0.67
R6407:Slc17a7 UTSW 7 45169926 missense probably benign 0.44
R6792:Slc17a7 UTSW 7 45174875 missense possibly damaging 0.50
R7404:Slc17a7 UTSW 7 45172930 missense probably benign 0.32
R8152:Slc17a7 UTSW 7 45170290 missense probably damaging 1.00
X0067:Slc17a7 UTSW 7 45170272 missense possibly damaging 0.94
Z1177:Slc17a7 UTSW 7 45172927 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCATCATAGTGAGGGCAG -3'
(R):5'- TGAGATCTGTAGGGAGGCAC -3'

Sequencing Primer
(F):5'- TCATAGTGAGGGCAGCCAAGC -3'
(R):5'- AGGAGTGCGACCTAGACCAC -3'
Posted On2020-01-23