Incidental Mutation 'R8001:Or51h1'
ID 616362
Institutional Source Beutler Lab
Gene Symbol Or51h1
Ensembl Gene ENSMUSG00000073970
Gene Name olfactory receptor family 51 subfamily H member 1
Synonyms MOR10-1, GA_x6K02T2PBJ9-5375442-5376389, Olfr555
MMRRC Submission 046041-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R8001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 102308030-102308977 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102308241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 71 (D71V)
Ref Sequence ENSEMBL: ENSMUSP00000095823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098220]
AlphaFold E9Q547
Predicted Effect probably damaging
Transcript: ENSMUST00000098220
AA Change: D71V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095823
Gene: ENSMUSG00000073970
AA Change: D71V

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.5e-126 PFAM
Pfam:7TM_GPCR_Srsx 36 308 1.7e-7 PFAM
Pfam:7tm_1 42 293 1.2e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acr A G 15: 89,458,165 (GRCm39) Y282C probably damaging Het
Alkbh4 A G 5: 136,169,123 (GRCm39) R136G probably damaging Het
Bptf C A 11: 106,938,166 (GRCm39) E2* probably null Het
Cse1l T A 2: 166,781,833 (GRCm39) F659Y probably damaging Het
Ctrc A T 4: 141,567,671 (GRCm39) L144Q probably damaging Het
Elmo1 A G 13: 20,470,902 (GRCm39) I265V probably benign Het
Erich3 T C 3: 154,419,553 (GRCm39) S19P probably benign Het
Hmcn1 A T 1: 150,540,629 (GRCm39) C2893* probably null Het
Hnrnpll G A 17: 80,346,152 (GRCm39) Q370* probably null Het
Itpkb T C 1: 180,160,059 (GRCm39) S62P probably damaging Het
Lig3 T A 11: 82,682,902 (GRCm39) C501S probably benign Het
Mab21l4 A G 1: 93,082,321 (GRCm39) L266P probably damaging Het
Nrxn1 C T 17: 91,395,964 (GRCm39) R64H possibly damaging Het
Ogfod2 T G 5: 124,252,946 (GRCm39) C319G probably damaging Het
Or5ac19 T C 16: 59,089,472 (GRCm39) N186S probably benign Het
Or5b118 A G 19: 13,448,786 (GRCm39) I109V probably benign Het
Or9k7 A G 10: 130,046,729 (GRCm39) V90A probably benign Het
Pabpc6 C A 17: 9,888,302 (GRCm39) R83L probably damaging Het
Pcdhgb2 A T 18: 37,823,687 (GRCm39) Q226L probably benign Het
Pole A T 5: 110,460,600 (GRCm39) I1127F probably damaging Het
Psg22 A T 7: 18,453,671 (GRCm39) Q161L possibly damaging Het
Slc17a7 A T 7: 44,818,212 (GRCm39) T46S probably benign Het
Smad4 A G 18: 73,774,881 (GRCm39) S473P probably damaging Het
Snap47 T A 11: 59,329,180 (GRCm39) T41S probably benign Het
Snx21 T C 2: 164,628,657 (GRCm39) L100P probably benign Het
Stc1 T A 14: 69,275,844 (GRCm39) N212K probably benign Het
Stk32a A T 18: 43,448,209 (GRCm39) N396I possibly damaging Het
Stox2 G A 8: 47,639,512 (GRCm39) P894L probably benign Het
Trav16d-dv11 A G 14: 53,284,744 (GRCm39) M1V probably null Het
Trim33 T C 3: 103,218,831 (GRCm39) probably null Het
Tyrp1 T C 4: 80,758,907 (GRCm39) V260A probably benign Het
Ush2a T C 1: 188,643,261 (GRCm39) Y4208H probably damaging Het
Vmn1r25 T A 6: 57,956,065 (GRCm39) K75* probably null Het
Vmn2r117 T A 17: 23,698,381 (GRCm39) N64I possibly damaging Het
Wdfy4 C T 14: 32,695,492 (GRCm39) probably null Het
Wnt8a A T 18: 34,678,569 (GRCm39) I128F probably damaging Het
Zc3h7b C A 15: 81,663,461 (GRCm39) Y484* probably null Het
Zfp619 A G 7: 39,184,645 (GRCm39) K225R probably benign Het
Other mutations in Or51h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Or51h1 APN 7 102,308,555 (GRCm39) missense probably damaging 0.98
IGL01150:Or51h1 APN 7 102,308,699 (GRCm39) missense probably benign 0.00
IGL02610:Or51h1 APN 7 102,308,774 (GRCm39) missense probably benign 0.41
IGL02679:Or51h1 APN 7 102,308,384 (GRCm39) missense possibly damaging 0.55
R0332:Or51h1 UTSW 7 102,308,672 (GRCm39) missense probably damaging 0.99
R1493:Or51h1 UTSW 7 102,308,220 (GRCm39) missense probably damaging 1.00
R1631:Or51h1 UTSW 7 102,308,408 (GRCm39) missense probably damaging 1.00
R1682:Or51h1 UTSW 7 102,308,904 (GRCm39) missense probably damaging 0.96
R3026:Or51h1 UTSW 7 102,308,336 (GRCm39) missense possibly damaging 0.90
R3103:Or51h1 UTSW 7 102,308,688 (GRCm39) missense probably benign 0.00
R4592:Or51h1 UTSW 7 102,308,685 (GRCm39) missense probably damaging 0.99
R4782:Or51h1 UTSW 7 102,308,041 (GRCm39) missense possibly damaging 0.63
R6282:Or51h1 UTSW 7 102,308,854 (GRCm39) missense probably benign 0.00
R7571:Or51h1 UTSW 7 102,308,258 (GRCm39) missense probably damaging 1.00
R8440:Or51h1 UTSW 7 102,308,275 (GRCm39) missense probably damaging 0.98
R9087:Or51h1 UTSW 7 102,308,964 (GRCm39) missense probably benign
R9182:Or51h1 UTSW 7 102,308,927 (GRCm39) missense probably damaging 0.98
R9336:Or51h1 UTSW 7 102,308,199 (GRCm39) missense probably damaging 0.97
R9710:Or51h1 UTSW 7 102,308,441 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTCTGACAGGCATCCCAGG -3'
(R):5'- GTCCAATCTTTCCAATAAGCCCATG -3'

Sequencing Primer
(F):5'- TCCCAGGGATGCCAGACAAG -3'
(R):5'- GCATAACGCAATGGGTCTCG -3'
Posted On 2020-01-23