Incidental Mutation 'R8001:Olfr555'
ID616362
Institutional Source Beutler Lab
Gene Symbol Olfr555
Ensembl Gene ENSMUSG00000073970
Gene Nameolfactory receptor 555
SynonymsMOR10-1, GA_x6K02T2PBJ9-5375442-5376389
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R8001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102658823-102659770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102659034 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 71 (D71V)
Ref Sequence ENSEMBL: ENSMUSP00000095823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098220]
Predicted Effect probably damaging
Transcript: ENSMUST00000098220
AA Change: D71V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095823
Gene: ENSMUSG00000073970
AA Change: D71V

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.5e-126 PFAM
Pfam:7TM_GPCR_Srsx 36 308 1.7e-7 PFAM
Pfam:7tm_1 42 293 1.2e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A G 1: 93,154,599 L266P probably damaging Het
Acr A G 15: 89,573,962 Y282C probably damaging Het
Alkbh4 A G 5: 136,140,269 R136G probably damaging Het
Bptf C A 11: 107,047,340 E2* probably null Het
Cse1l T A 2: 166,939,913 F659Y probably damaging Het
Ctrc A T 4: 141,840,360 L144Q probably damaging Het
Elmo1 A G 13: 20,286,732 I265V probably benign Het
Erich3 T C 3: 154,713,916 S19P probably benign Het
Hmcn1 A T 1: 150,664,878 C2893* probably null Het
Hnrnpll G A 17: 80,038,723 Q370* probably null Het
Itpkb T C 1: 180,332,494 S62P probably damaging Het
Lig3 T A 11: 82,792,076 C501S probably benign Het
Nrxn1 C T 17: 91,088,536 R64H possibly damaging Het
Ogfod2 T G 5: 124,114,883 C319G probably damaging Het
Olfr1474 A G 19: 13,471,422 I109V probably benign Het
Olfr201 T C 16: 59,269,109 N186S probably benign Het
Olfr827 A G 10: 130,210,860 V90A probably benign Het
Pabpc6 C A 17: 9,669,373 R83L probably damaging Het
Pcdhgb2 A T 18: 37,690,634 Q226L probably benign Het
Pole A T 5: 110,312,734 I1127F probably damaging Het
Psg22 A T 7: 18,719,746 Q161L possibly damaging Het
Slc17a7 A T 7: 45,168,788 T46S probably benign Het
Smad4 A G 18: 73,641,810 S473P probably damaging Het
Snap47 T A 11: 59,438,354 T41S probably benign Het
Snx21 T C 2: 164,786,737 L100P probably benign Het
Stc1 T A 14: 69,038,395 N212K probably benign Het
Stk32a A T 18: 43,315,144 N396I possibly damaging Het
Stox2 G A 8: 47,186,477 P894L probably benign Het
Trav16d-dv11 A G 14: 53,047,287 M1V probably null Het
Trim33 T C 3: 103,311,515 probably null Het
Tyrp1 T C 4: 80,840,670 V260A probably benign Het
Ush2a T C 1: 188,911,064 Y4208H probably damaging Het
Vmn1r25 T A 6: 57,979,080 K75* probably null Het
Vmn2r117 T A 17: 23,479,407 N64I possibly damaging Het
Wdfy4 C T 14: 32,973,535 probably null Het
Wnt8a A T 18: 34,545,516 I128F probably damaging Het
Zc3h7b C A 15: 81,779,260 Y484* probably null Het
Zfp619 A G 7: 39,535,221 K225R probably benign Het
Other mutations in Olfr555
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr555 APN 7 102659348 missense probably damaging 0.98
IGL01150:Olfr555 APN 7 102659492 missense probably benign 0.00
IGL02610:Olfr555 APN 7 102659567 missense probably benign 0.41
IGL02679:Olfr555 APN 7 102659177 missense possibly damaging 0.55
R0332:Olfr555 UTSW 7 102659465 missense probably damaging 0.99
R1493:Olfr555 UTSW 7 102659013 missense probably damaging 1.00
R1631:Olfr555 UTSW 7 102659201 missense probably damaging 1.00
R1682:Olfr555 UTSW 7 102659697 missense probably damaging 0.96
R3026:Olfr555 UTSW 7 102659129 missense possibly damaging 0.90
R3103:Olfr555 UTSW 7 102659481 missense probably benign 0.00
R4592:Olfr555 UTSW 7 102659478 missense probably damaging 0.99
R4782:Olfr555 UTSW 7 102658834 missense possibly damaging 0.63
R6282:Olfr555 UTSW 7 102659647 missense probably benign 0.00
R7571:Olfr555 UTSW 7 102659051 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTGACAGGCATCCCAGG -3'
(R):5'- GTCCAATCTTTCCAATAAGCCCATG -3'

Sequencing Primer
(F):5'- TCCCAGGGATGCCAGACAAG -3'
(R):5'- GCATAACGCAATGGGTCTCG -3'
Posted On2020-01-23