Incidental Mutation 'R8001:Snap47'
ID 616365
Institutional Source Beutler Lab
Gene Symbol Snap47
Ensembl Gene ENSMUSG00000009894
Gene Name synaptosomal-associated protein, 47
Synonyms SNAP-47, 1110031B06Rik
MMRRC Submission 046041-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 59297967-59340868 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59329180 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 41 (T41S)
Ref Sequence ENSEMBL: ENSMUSP00000010038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010038] [ENSMUST00000120940] [ENSMUST00000125846] [ENSMUST00000132969] [ENSMUST00000136436] [ENSMUST00000145550] [ENSMUST00000150297] [ENSMUST00000156146]
AlphaFold Q8R570
Predicted Effect probably benign
Transcript: ENSMUST00000010038
AA Change: T41S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000010038
Gene: ENSMUSG00000009894
AA Change: T41S

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
SCOP:d1fpza_ 181 234 3e-3 SMART
low complexity region 335 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120940
AA Change: T41S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113555
Gene: ENSMUSG00000009894
AA Change: T41S

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
SCOP:d1fpza_ 181 234 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125846
Predicted Effect probably benign
Transcript: ENSMUST00000132969
AA Change: T41S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116170
Gene: ENSMUSG00000009894
AA Change: T41S

DomainStartEndE-ValueType
coiled coil region 125 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136436
AA Change: T41S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115762
Gene: ENSMUSG00000009894
AA Change: T41S

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145550
AA Change: T41S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000150297
AA Change: T41S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000156146
AA Change: T41S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121880
Gene: ENSMUSG00000009894
AA Change: T41S

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acr A G 15: 89,458,165 (GRCm39) Y282C probably damaging Het
Alkbh4 A G 5: 136,169,123 (GRCm39) R136G probably damaging Het
Bptf C A 11: 106,938,166 (GRCm39) E2* probably null Het
Cse1l T A 2: 166,781,833 (GRCm39) F659Y probably damaging Het
Ctrc A T 4: 141,567,671 (GRCm39) L144Q probably damaging Het
Elmo1 A G 13: 20,470,902 (GRCm39) I265V probably benign Het
Erich3 T C 3: 154,419,553 (GRCm39) S19P probably benign Het
Hmcn1 A T 1: 150,540,629 (GRCm39) C2893* probably null Het
Hnrnpll G A 17: 80,346,152 (GRCm39) Q370* probably null Het
Itpkb T C 1: 180,160,059 (GRCm39) S62P probably damaging Het
Lig3 T A 11: 82,682,902 (GRCm39) C501S probably benign Het
Mab21l4 A G 1: 93,082,321 (GRCm39) L266P probably damaging Het
Nrxn1 C T 17: 91,395,964 (GRCm39) R64H possibly damaging Het
Ogfod2 T G 5: 124,252,946 (GRCm39) C319G probably damaging Het
Or51h1 A T 7: 102,308,241 (GRCm39) D71V probably damaging Het
Or5ac19 T C 16: 59,089,472 (GRCm39) N186S probably benign Het
Or5b118 A G 19: 13,448,786 (GRCm39) I109V probably benign Het
Or9k7 A G 10: 130,046,729 (GRCm39) V90A probably benign Het
Pabpc6 C A 17: 9,888,302 (GRCm39) R83L probably damaging Het
Pcdhgb2 A T 18: 37,823,687 (GRCm39) Q226L probably benign Het
Pole A T 5: 110,460,600 (GRCm39) I1127F probably damaging Het
Psg22 A T 7: 18,453,671 (GRCm39) Q161L possibly damaging Het
Slc17a7 A T 7: 44,818,212 (GRCm39) T46S probably benign Het
Smad4 A G 18: 73,774,881 (GRCm39) S473P probably damaging Het
Snx21 T C 2: 164,628,657 (GRCm39) L100P probably benign Het
Stc1 T A 14: 69,275,844 (GRCm39) N212K probably benign Het
Stk32a A T 18: 43,448,209 (GRCm39) N396I possibly damaging Het
Stox2 G A 8: 47,639,512 (GRCm39) P894L probably benign Het
Trav16d-dv11 A G 14: 53,284,744 (GRCm39) M1V probably null Het
Trim33 T C 3: 103,218,831 (GRCm39) probably null Het
Tyrp1 T C 4: 80,758,907 (GRCm39) V260A probably benign Het
Ush2a T C 1: 188,643,261 (GRCm39) Y4208H probably damaging Het
Vmn1r25 T A 6: 57,956,065 (GRCm39) K75* probably null Het
Vmn2r117 T A 17: 23,698,381 (GRCm39) N64I possibly damaging Het
Wdfy4 C T 14: 32,695,492 (GRCm39) probably null Het
Wnt8a A T 18: 34,678,569 (GRCm39) I128F probably damaging Het
Zc3h7b C A 15: 81,663,461 (GRCm39) Y484* probably null Het
Zfp619 A G 7: 39,184,645 (GRCm39) K225R probably benign Het
Other mutations in Snap47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Snap47 APN 11 59,312,477 (GRCm39) critical splice acceptor site probably null
IGL02113:Snap47 APN 11 59,319,262 (GRCm39) missense probably damaging 0.99
IGL03290:Snap47 APN 11 59,319,424 (GRCm39) missense probably damaging 1.00
R0126:Snap47 UTSW 11 59,328,813 (GRCm39) missense probably damaging 0.99
R0582:Snap47 UTSW 11 59,319,259 (GRCm39) nonsense probably null
R0633:Snap47 UTSW 11 59,319,439 (GRCm39) missense probably benign 0.25
R0883:Snap47 UTSW 11 59,329,326 (GRCm39) utr 5 prime probably benign
R1657:Snap47 UTSW 11 59,319,596 (GRCm39) missense probably benign 0.08
R1855:Snap47 UTSW 11 59,319,159 (GRCm39) unclassified probably benign
R2761:Snap47 UTSW 11 59,328,885 (GRCm39) missense probably benign 0.01
R4079:Snap47 UTSW 11 59,319,377 (GRCm39) missense probably benign 0.38
R4805:Snap47 UTSW 11 59,319,343 (GRCm39) missense possibly damaging 0.91
R4960:Snap47 UTSW 11 59,319,369 (GRCm39) missense probably damaging 1.00
R5212:Snap47 UTSW 11 59,319,178 (GRCm39) missense probably damaging 0.99
R5793:Snap47 UTSW 11 59,329,018 (GRCm39) missense probably damaging 1.00
R7243:Snap47 UTSW 11 59,319,548 (GRCm39) missense probably benign 0.04
R7603:Snap47 UTSW 11 59,319,373 (GRCm39) missense probably damaging 1.00
R7870:Snap47 UTSW 11 59,328,904 (GRCm39) missense probably benign 0.11
R9156:Snap47 UTSW 11 59,319,290 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCAGCTCCCTCCAGAAATG -3'
(R):5'- AAAGGGATACATTGCAGGCTC -3'

Sequencing Primer
(F):5'- CCTCCAGAAATGTTCGATGACGTTG -3'
(R):5'- AGGGATACATTGCAGGCTCATCTG -3'
Posted On 2020-01-23