Incidental Mutation 'R8001:Snap47'
ID616365
Institutional Source Beutler Lab
Gene Symbol Snap47
Ensembl Gene ENSMUSG00000009894
Gene Namesynaptosomal-associated protein, 47
SynonymsSNAP-47, 1110031B06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location59407134-59451186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59438354 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 41 (T41S)
Ref Sequence ENSEMBL: ENSMUSP00000010038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010038] [ENSMUST00000120940] [ENSMUST00000125846] [ENSMUST00000132969] [ENSMUST00000136436] [ENSMUST00000145550] [ENSMUST00000150297] [ENSMUST00000156146]
Predicted Effect probably benign
Transcript: ENSMUST00000010038
AA Change: T41S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000010038
Gene: ENSMUSG00000009894
AA Change: T41S

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
SCOP:d1fpza_ 181 234 3e-3 SMART
low complexity region 335 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120940
AA Change: T41S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113555
Gene: ENSMUSG00000009894
AA Change: T41S

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
SCOP:d1fpza_ 181 234 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125846
Predicted Effect probably benign
Transcript: ENSMUST00000132969
AA Change: T41S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116170
Gene: ENSMUSG00000009894
AA Change: T41S

DomainStartEndE-ValueType
coiled coil region 125 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136436
AA Change: T41S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115762
Gene: ENSMUSG00000009894
AA Change: T41S

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145550
AA Change: T41S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000150297
AA Change: T41S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000156146
AA Change: T41S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121880
Gene: ENSMUSG00000009894
AA Change: T41S

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A G 1: 93,154,599 L266P probably damaging Het
Acr A G 15: 89,573,962 Y282C probably damaging Het
Alkbh4 A G 5: 136,140,269 R136G probably damaging Het
Bptf C A 11: 107,047,340 E2* probably null Het
Cse1l T A 2: 166,939,913 F659Y probably damaging Het
Ctrc A T 4: 141,840,360 L144Q probably damaging Het
Elmo1 A G 13: 20,286,732 I265V probably benign Het
Erich3 T C 3: 154,713,916 S19P probably benign Het
Hmcn1 A T 1: 150,664,878 C2893* probably null Het
Hnrnpll G A 17: 80,038,723 Q370* probably null Het
Itpkb T C 1: 180,332,494 S62P probably damaging Het
Lig3 T A 11: 82,792,076 C501S probably benign Het
Nrxn1 C T 17: 91,088,536 R64H possibly damaging Het
Ogfod2 T G 5: 124,114,883 C319G probably damaging Het
Olfr1474 A G 19: 13,471,422 I109V probably benign Het
Olfr201 T C 16: 59,269,109 N186S probably benign Het
Olfr555 A T 7: 102,659,034 D71V probably damaging Het
Olfr827 A G 10: 130,210,860 V90A probably benign Het
Pabpc6 C A 17: 9,669,373 R83L probably damaging Het
Pcdhgb2 A T 18: 37,690,634 Q226L probably benign Het
Pole A T 5: 110,312,734 I1127F probably damaging Het
Psg22 A T 7: 18,719,746 Q161L possibly damaging Het
Slc17a7 A T 7: 45,168,788 T46S probably benign Het
Smad4 A G 18: 73,641,810 S473P probably damaging Het
Snx21 T C 2: 164,786,737 L100P probably benign Het
Stc1 T A 14: 69,038,395 N212K probably benign Het
Stk32a A T 18: 43,315,144 N396I possibly damaging Het
Stox2 G A 8: 47,186,477 P894L probably benign Het
Trav16d-dv11 A G 14: 53,047,287 M1V probably null Het
Trim33 T C 3: 103,311,515 probably null Het
Tyrp1 T C 4: 80,840,670 V260A probably benign Het
Ush2a T C 1: 188,911,064 Y4208H probably damaging Het
Vmn1r25 T A 6: 57,979,080 K75* probably null Het
Vmn2r117 T A 17: 23,479,407 N64I possibly damaging Het
Wdfy4 C T 14: 32,973,535 probably null Het
Wnt8a A T 18: 34,545,516 I128F probably damaging Het
Zc3h7b C A 15: 81,779,260 Y484* probably null Het
Zfp619 A G 7: 39,535,221 K225R probably benign Het
Other mutations in Snap47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Snap47 APN 11 59421651 critical splice acceptor site probably null
IGL02113:Snap47 APN 11 59428436 missense probably damaging 0.99
IGL03290:Snap47 APN 11 59428598 missense probably damaging 1.00
R0126:Snap47 UTSW 11 59437987 missense probably damaging 0.99
R0582:Snap47 UTSW 11 59428433 nonsense probably null
R0633:Snap47 UTSW 11 59428613 missense probably benign 0.25
R0883:Snap47 UTSW 11 59438500 utr 5 prime probably benign
R1657:Snap47 UTSW 11 59428770 missense probably benign 0.08
R1855:Snap47 UTSW 11 59428333 unclassified probably benign
R2761:Snap47 UTSW 11 59438059 missense probably benign 0.01
R4079:Snap47 UTSW 11 59428551 missense probably benign 0.38
R4805:Snap47 UTSW 11 59428517 missense possibly damaging 0.91
R4960:Snap47 UTSW 11 59428543 missense probably damaging 1.00
R5212:Snap47 UTSW 11 59428352 missense probably damaging 0.99
R5793:Snap47 UTSW 11 59438192 missense probably damaging 1.00
R7243:Snap47 UTSW 11 59428722 missense probably benign 0.04
R7603:Snap47 UTSW 11 59428547 missense probably damaging 1.00
R7870:Snap47 UTSW 11 59438078 missense probably benign 0.11
R7953:Snap47 UTSW 11 59438078 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TAGCAGCTCCCTCCAGAAATG -3'
(R):5'- AAAGGGATACATTGCAGGCTC -3'

Sequencing Primer
(F):5'- CCTCCAGAAATGTTCGATGACGTTG -3'
(R):5'- AGGGATACATTGCAGGCTCATCTG -3'
Posted On2020-01-23