Incidental Mutation 'R8001:Zc3h7b'
ID616372
Institutional Source Beutler Lab
Gene Symbol Zc3h7b
Ensembl Gene ENSMUSG00000022390
Gene Namezinc finger CCCH type containing 7B
SynonymsScrg3
Accession Numbers

Genbank: NM_001081016; MGI: 1328310

Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R8001 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location81745057-81796260 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 81779260 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 484 (Y484*)
Ref Sequence ENSEMBL: ENSMUSP00000105181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109554]
Predicted Effect probably null
Transcript: ENSMUST00000109554
AA Change: Y484*
SMART Domains Protein: ENSMUSP00000105181
Gene: ENSMUSG00000022390
AA Change: Y484*

DomainStartEndE-ValueType
Pfam:TPR_11 34 113 2.3e-12 PFAM
Pfam:TPR_1 82 115 2.4e-6 PFAM
Pfam:TPR_8 82 115 8.2e-4 PFAM
Pfam:TPR_8 116 143 4.8e-3 PFAM
low complexity region 294 309 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C3H1 482 508 2.15e1 SMART
ZnF_C3H1 612 638 2.03e1 SMART
ZnF_C3H1 757 782 8.31e0 SMART
ZnF_C2H2 843 867 2.86e-1 SMART
ZnF_C3H1 889 914 7.81e-1 SMART
low complexity region 959 981 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a tetratricopeptide repeat domain. The encoded protein also interacts with the rotavirus non-structural protein NSP3. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(9) : Gene trapped(9)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A G 1: 93,154,599 L266P probably damaging Het
Acr A G 15: 89,573,962 Y282C probably damaging Het
Alkbh4 A G 5: 136,140,269 R136G probably damaging Het
Bptf C A 11: 107,047,340 E2* probably null Het
Cse1l T A 2: 166,939,913 F659Y probably damaging Het
Ctrc A T 4: 141,840,360 L144Q probably damaging Het
Elmo1 A G 13: 20,286,732 I265V probably benign Het
Erich3 T C 3: 154,713,916 S19P probably benign Het
Hmcn1 A T 1: 150,664,878 C2893* probably null Het
Hnrnpll G A 17: 80,038,723 Q370* probably null Het
Itpkb T C 1: 180,332,494 S62P probably damaging Het
Lig3 T A 11: 82,792,076 C501S probably benign Het
Nrxn1 C T 17: 91,088,536 R64H possibly damaging Het
Ogfod2 T G 5: 124,114,883 C319G probably damaging Het
Olfr1474 A G 19: 13,471,422 I109V probably benign Het
Olfr201 T C 16: 59,269,109 N186S probably benign Het
Olfr555 A T 7: 102,659,034 D71V probably damaging Het
Olfr827 A G 10: 130,210,860 V90A probably benign Het
Pabpc6 C A 17: 9,669,373 R83L probably damaging Het
Pcdhgb2 A T 18: 37,690,634 Q226L probably benign Het
Pole A T 5: 110,312,734 I1127F probably damaging Het
Psg22 A T 7: 18,719,746 Q161L possibly damaging Het
Slc17a7 A T 7: 45,168,788 T46S probably benign Het
Smad4 A G 18: 73,641,810 S473P probably damaging Het
Snap47 T A 11: 59,438,354 T41S probably benign Het
Snx21 T C 2: 164,786,737 L100P probably benign Het
Stc1 T A 14: 69,038,395 N212K probably benign Het
Stk32a A T 18: 43,315,144 N396I possibly damaging Het
Stox2 G A 8: 47,186,477 P894L probably benign Het
Trav16d-dv11 A G 14: 53,047,287 M1V probably null Het
Trim33 T C 3: 103,311,515 probably null Het
Tyrp1 T C 4: 80,840,670 V260A probably benign Het
Ush2a T C 1: 188,911,064 Y4208H probably damaging Het
Vmn1r25 T A 6: 57,979,080 K75* probably null Het
Vmn2r117 T A 17: 23,479,407 N64I possibly damaging Het
Wdfy4 C T 14: 32,973,535 probably null Het
Wnt8a A T 18: 34,545,516 I128F probably damaging Het
Zfp619 A G 7: 39,535,221 K225R probably benign Het
Other mutations in Zc3h7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Zc3h7b APN 15 81771799 missense possibly damaging 0.95
IGL01955:Zc3h7b APN 15 81792004 missense probably benign 0.10
IGL02526:Zc3h7b APN 15 81793137 missense probably benign 0.10
IGL02582:Zc3h7b APN 15 81769140 missense probably benign 0.05
IGL02736:Zc3h7b APN 15 81791974 missense probably benign 0.02
F6893:Zc3h7b UTSW 15 81778671 missense possibly damaging 0.94
R0212:Zc3h7b UTSW 15 81776328 missense probably benign 0.00
R0242:Zc3h7b UTSW 15 81768830 splice site probably benign
R0471:Zc3h7b UTSW 15 81781968 missense probably damaging 1.00
R0590:Zc3h7b UTSW 15 81776998 missense possibly damaging 0.74
R1530:Zc3h7b UTSW 15 81777088 missense probably benign
R1563:Zc3h7b UTSW 15 81777088 missense probably benign
R1565:Zc3h7b UTSW 15 81777088 missense probably benign
R1566:Zc3h7b UTSW 15 81768834 missense possibly damaging 0.91
R1670:Zc3h7b UTSW 15 81777067 missense probably benign
R1712:Zc3h7b UTSW 15 81777088 missense probably benign
R1727:Zc3h7b UTSW 15 81768029 missense probably damaging 1.00
R2069:Zc3h7b UTSW 15 81792328 missense probably damaging 0.98
R2375:Zc3h7b UTSW 15 81792502 missense probably benign 0.17
R2656:Zc3h7b UTSW 15 81780430 missense probably damaging 1.00
R4660:Zc3h7b UTSW 15 81792250 missense probably benign 0.07
R4764:Zc3h7b UTSW 15 81769183 critical splice donor site probably null
R4815:Zc3h7b UTSW 15 81793663 missense probably damaging 1.00
R4999:Zc3h7b UTSW 15 81779133 missense probably damaging 1.00
R5086:Zc3h7b UTSW 15 81793174 missense probably damaging 0.96
R5169:Zc3h7b UTSW 15 81773314 missense probably benign 0.01
R5395:Zc3h7b UTSW 15 81772501 missense possibly damaging 0.50
R5407:Zc3h7b UTSW 15 81785891 missense probably damaging 0.99
R5587:Zc3h7b UTSW 15 81771858 missense possibly damaging 0.80
R5721:Zc3h7b UTSW 15 81773298 missense probably benign 0.02
R6001:Zc3h7b UTSW 15 81792035 missense possibly damaging 0.89
R6151:Zc3h7b UTSW 15 81778710 critical splice donor site probably null
R6248:Zc3h7b UTSW 15 81783185 missense probably damaging 1.00
R6397:Zc3h7b UTSW 15 81792854 missense probably benign 0.03
R6502:Zc3h7b UTSW 15 81769051 missense probably benign 0.01
R7248:Zc3h7b UTSW 15 81771787 missense possibly damaging 0.46
R7397:Zc3h7b UTSW 15 81769153 missense possibly damaging 0.50
R7450:Zc3h7b UTSW 15 81783080 missense probably benign
R7471:Zc3h7b UTSW 15 81780481 missense probably damaging 1.00
R7575:Zc3h7b UTSW 15 81777885 nonsense probably null
R7645:Zc3h7b UTSW 15 81780602 missense probably damaging 1.00
R7650:Zc3h7b UTSW 15 81793650 missense possibly damaging 0.81
R7881:Zc3h7b UTSW 15 81780478 missense probably damaging 1.00
R7964:Zc3h7b UTSW 15 81780478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTTCAGAGACCCAGATGAG -3'
(R):5'- AGCATATCCTGAATGACCTCCG -3'

Sequencing Primer
(F):5'- CACGTGGGTTTTCTGGATTCACAC -3'
(R):5'- GAATGACCTCCGTCTTCAGAC -3'
Posted On2020-01-23