Incidental Mutation 'R8001:Vmn2r117'
ID 616376
Institutional Source Beutler Lab
Gene Symbol Vmn2r117
Ensembl Gene ENSMUSG00000091407
Gene Name vomeronasal 2, receptor 117
Synonyms EG619788, V2Rp6
MMRRC Submission 046041-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R8001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23678649-23698571 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23698381 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 64 (N64I)
Ref Sequence ENSEMBL: ENSMUSP00000126885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171996]
AlphaFold K7N6V1
Predicted Effect possibly damaging
Transcript: ENSMUST00000171996
AA Change: N64I

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: N64I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.6e-28 PFAM
Pfam:NCD3G 512 565 5e-20 PFAM
Pfam:7tm_3 595 833 8.2e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acr A G 15: 89,458,165 (GRCm39) Y282C probably damaging Het
Alkbh4 A G 5: 136,169,123 (GRCm39) R136G probably damaging Het
Bptf C A 11: 106,938,166 (GRCm39) E2* probably null Het
Cse1l T A 2: 166,781,833 (GRCm39) F659Y probably damaging Het
Ctrc A T 4: 141,567,671 (GRCm39) L144Q probably damaging Het
Elmo1 A G 13: 20,470,902 (GRCm39) I265V probably benign Het
Erich3 T C 3: 154,419,553 (GRCm39) S19P probably benign Het
Hmcn1 A T 1: 150,540,629 (GRCm39) C2893* probably null Het
Hnrnpll G A 17: 80,346,152 (GRCm39) Q370* probably null Het
Itpkb T C 1: 180,160,059 (GRCm39) S62P probably damaging Het
Lig3 T A 11: 82,682,902 (GRCm39) C501S probably benign Het
Mab21l4 A G 1: 93,082,321 (GRCm39) L266P probably damaging Het
Nrxn1 C T 17: 91,395,964 (GRCm39) R64H possibly damaging Het
Ogfod2 T G 5: 124,252,946 (GRCm39) C319G probably damaging Het
Or51h1 A T 7: 102,308,241 (GRCm39) D71V probably damaging Het
Or5ac19 T C 16: 59,089,472 (GRCm39) N186S probably benign Het
Or5b118 A G 19: 13,448,786 (GRCm39) I109V probably benign Het
Or9k7 A G 10: 130,046,729 (GRCm39) V90A probably benign Het
Pabpc6 C A 17: 9,888,302 (GRCm39) R83L probably damaging Het
Pcdhgb2 A T 18: 37,823,687 (GRCm39) Q226L probably benign Het
Pole A T 5: 110,460,600 (GRCm39) I1127F probably damaging Het
Psg22 A T 7: 18,453,671 (GRCm39) Q161L possibly damaging Het
Slc17a7 A T 7: 44,818,212 (GRCm39) T46S probably benign Het
Smad4 A G 18: 73,774,881 (GRCm39) S473P probably damaging Het
Snap47 T A 11: 59,329,180 (GRCm39) T41S probably benign Het
Snx21 T C 2: 164,628,657 (GRCm39) L100P probably benign Het
Stc1 T A 14: 69,275,844 (GRCm39) N212K probably benign Het
Stk32a A T 18: 43,448,209 (GRCm39) N396I possibly damaging Het
Stox2 G A 8: 47,639,512 (GRCm39) P894L probably benign Het
Trav16d-dv11 A G 14: 53,284,744 (GRCm39) M1V probably null Het
Trim33 T C 3: 103,218,831 (GRCm39) probably null Het
Tyrp1 T C 4: 80,758,907 (GRCm39) V260A probably benign Het
Ush2a T C 1: 188,643,261 (GRCm39) Y4208H probably damaging Het
Vmn1r25 T A 6: 57,956,065 (GRCm39) K75* probably null Het
Wdfy4 C T 14: 32,695,492 (GRCm39) probably null Het
Wnt8a A T 18: 34,678,569 (GRCm39) I128F probably damaging Het
Zc3h7b C A 15: 81,663,461 (GRCm39) Y484* probably null Het
Zfp619 A G 7: 39,184,645 (GRCm39) K225R probably benign Het
Other mutations in Vmn2r117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r117 APN 17 23,698,520 (GRCm39) missense probably benign
IGL00990:Vmn2r117 APN 17 23,696,814 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23,694,403 (GRCm39) missense probably damaging 1.00
IGL01078:Vmn2r117 APN 17 23,696,778 (GRCm39) missense probably damaging 1.00
IGL01139:Vmn2r117 APN 17 23,696,778 (GRCm39) missense probably damaging 1.00
IGL01374:Vmn2r117 APN 17 23,697,356 (GRCm39) missense possibly damaging 0.46
IGL01779:Vmn2r117 APN 17 23,696,215 (GRCm39) missense probably benign 0.00
IGL02283:Vmn2r117 APN 17 23,694,356 (GRCm39) missense probably damaging 0.99
IGL02527:Vmn2r117 APN 17 23,696,199 (GRCm39) missense possibly damaging 0.65
IGL02612:Vmn2r117 APN 17 23,678,758 (GRCm39) missense possibly damaging 0.91
IGL02887:Vmn2r117 APN 17 23,694,552 (GRCm39) splice site probably benign
IGL03167:Vmn2r117 APN 17 23,696,681 (GRCm39) missense probably damaging 1.00
R0315:Vmn2r117 UTSW 17 23,679,139 (GRCm39) missense probably benign 0.11
R0610:Vmn2r117 UTSW 17 23,694,488 (GRCm39) missense probably benign 0.00
R0747:Vmn2r117 UTSW 17 23,694,477 (GRCm39) nonsense probably null
R1411:Vmn2r117 UTSW 17 23,679,527 (GRCm39) missense probably damaging 1.00
R1471:Vmn2r117 UTSW 17 23,697,447 (GRCm39) missense probably benign 0.00
R1853:Vmn2r117 UTSW 17 23,696,429 (GRCm39) missense probably damaging 0.99
R1925:Vmn2r117 UTSW 17 23,697,363 (GRCm39) missense probably benign 0.00
R1940:Vmn2r117 UTSW 17 23,696,454 (GRCm39) missense probably damaging 1.00
R2005:Vmn2r117 UTSW 17 23,696,618 (GRCm39) missense probably damaging 1.00
R2082:Vmn2r117 UTSW 17 23,679,230 (GRCm39) missense possibly damaging 0.55
R2698:Vmn2r117 UTSW 17 23,678,885 (GRCm39) missense probably damaging 0.98
R2972:Vmn2r117 UTSW 17 23,678,830 (GRCm39) missense probably damaging 1.00
R2973:Vmn2r117 UTSW 17 23,678,830 (GRCm39) missense probably damaging 1.00
R2974:Vmn2r117 UTSW 17 23,678,830 (GRCm39) missense probably damaging 1.00
R3160:Vmn2r117 UTSW 17 23,679,352 (GRCm39) missense probably damaging 1.00
R3161:Vmn2r117 UTSW 17 23,679,352 (GRCm39) missense probably damaging 1.00
R3162:Vmn2r117 UTSW 17 23,679,352 (GRCm39) missense probably damaging 1.00
R3847:Vmn2r117 UTSW 17 23,679,389 (GRCm39) missense probably damaging 0.97
R3848:Vmn2r117 UTSW 17 23,679,389 (GRCm39) missense probably damaging 0.97
R4082:Vmn2r117 UTSW 17 23,679,080 (GRCm39) missense probably benign 0.00
R4320:Vmn2r117 UTSW 17 23,698,487 (GRCm39) frame shift probably null
R4560:Vmn2r117 UTSW 17 23,678,851 (GRCm39) missense probably damaging 1.00
R4658:Vmn2r117 UTSW 17 23,697,390 (GRCm39) missense probably benign 0.01
R4881:Vmn2r117 UTSW 17 23,696,859 (GRCm39) missense probably damaging 1.00
R4908:Vmn2r117 UTSW 17 23,678,812 (GRCm39) missense probably damaging 1.00
R4910:Vmn2r117 UTSW 17 23,698,487 (GRCm39) frame shift probably null
R5078:Vmn2r117 UTSW 17 23,679,122 (GRCm39) missense probably damaging 1.00
R5327:Vmn2r117 UTSW 17 23,696,848 (GRCm39) nonsense probably null
R5774:Vmn2r117 UTSW 17 23,696,176 (GRCm39) missense probably damaging 0.98
R6014:Vmn2r117 UTSW 17 23,698,535 (GRCm39) missense probably damaging 0.97
R6390:Vmn2r117 UTSW 17 23,679,088 (GRCm39) missense possibly damaging 0.95
R6520:Vmn2r117 UTSW 17 23,679,193 (GRCm39) missense probably damaging 0.99
R6674:Vmn2r117 UTSW 17 23,679,023 (GRCm39) nonsense probably null
R6736:Vmn2r117 UTSW 17 23,697,282 (GRCm39) missense probably damaging 0.99
R6909:Vmn2r117 UTSW 17 23,698,479 (GRCm39) missense possibly damaging 0.67
R6913:Vmn2r117 UTSW 17 23,698,537 (GRCm39) missense probably damaging 0.99
R7220:Vmn2r117 UTSW 17 23,696,177 (GRCm39) missense probably damaging 1.00
R7260:Vmn2r117 UTSW 17 23,694,359 (GRCm39) missense probably benign 0.06
R7440:Vmn2r117 UTSW 17 23,694,539 (GRCm39) missense probably benign 0.26
R7443:Vmn2r117 UTSW 17 23,679,319 (GRCm39) missense probably damaging 1.00
R7443:Vmn2r117 UTSW 17 23,679,107 (GRCm39) missense probably benign 0.25
R7449:Vmn2r117 UTSW 17 23,678,869 (GRCm39) missense probably damaging 1.00
R7644:Vmn2r117 UTSW 17 23,696,265 (GRCm39) missense probably damaging 0.98
R7914:Vmn2r117 UTSW 17 23,679,100 (GRCm39) missense possibly damaging 0.95
R8029:Vmn2r117 UTSW 17 23,696,744 (GRCm39) missense probably benign 0.00
R8340:Vmn2r117 UTSW 17 23,679,511 (GRCm39) missense probably benign 0.01
R8519:Vmn2r117 UTSW 17 23,698,442 (GRCm39) missense probably benign
R8723:Vmn2r117 UTSW 17 23,696,343 (GRCm39) missense probably damaging 1.00
R8914:Vmn2r117 UTSW 17 23,679,143 (GRCm39) missense probably benign 0.02
R9010:Vmn2r117 UTSW 17 23,679,445 (GRCm39) missense probably benign 0.10
R9129:Vmn2r117 UTSW 17 23,678,918 (GRCm39) nonsense probably null
R9244:Vmn2r117 UTSW 17 23,696,589 (GRCm39) missense probably damaging 0.98
R9464:Vmn2r117 UTSW 17 23,696,578 (GRCm39) missense probably benign 0.23
R9620:Vmn2r117 UTSW 17 23,697,450 (GRCm39) missense probably damaging 0.97
V5622:Vmn2r117 UTSW 17 23,698,479 (GRCm39) missense possibly damaging 0.67
V5622:Vmn2r117 UTSW 17 23,696,814 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r117 UTSW 17 23,678,740 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCATTCCTAAGTGTGAGGC -3'
(R):5'- CAATTCTGCCCAGGCTCAGAAG -3'

Sequencing Primer
(F):5'- CTAGCTCTTTCCTGTTATGGA -3'
(R):5'- CTCAGAAGAGGAAAAATATGTTCACC -3'
Posted On 2020-01-23