Mutagenetix > Incidental Mutation

Incidental Mutation 'R8001:Hnrnpll'

616377

Institutional Source

Beutler Lab

Gene Symbol

Hnrnpll

Ensembl Gene

ENSMUSG00000024095

Gene Name

heterogeneous nuclear ribonucleoprotein L-like

Synonyms

2510028H02Rik, Hnrpll, 2810036L13Rik

MMRRC Submission

Accession Numbers

Genbank: NM_144802; MGI: 1919942

Essential gene?

Probably essential (E-score: 0.810) question?

Stock #

R8001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80029487-80062334 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 80038723 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 370 (Q370*)

Ref Sequence

ENSEMBL: ENSMUSP00000139372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061331] [ENSMUST00000184297] [ENSMUST00000184635]

AlphaFold

Q921F4

Predicted Effect

probably null
Transcript: ENSMUST00000061331
AA Change: Q370*

SMART Domains

Protein: ENSMUSP00000058308
Gene: ENSMUSG00000024095
AA Change: Q370*

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART
low complexity region	314	325	N/A	INTRINSIC
RRM	385	454	1.36e-7	SMART
Blast:RRM_2	504	582	3e-32	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000184297

SMART Domains

Protein: ENSMUSP00000139075
Gene: ENSMUSG00000024095

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000184635
AA Change: Q370*

SMART Domains

Protein: ENSMUSP00000139372
Gene: ENSMUSG00000024095
AA Change: Q370*

Domain	Start	End	E-Value	Type
low complexity region	52	104	N/A	INTRINSIC
RRM	126	195	2.99e-4	SMART
RRM	216	289	1.26e-2	SMART
low complexity region	314	325	N/A	INTRINSIC
RRM	385	454	1.36e-7	SMART
Blast:RRM_2	504	582	3e-32	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a point mutation in a RNA recognition motif of the gene product have defects in the generation of alternative transcripts normally found in memory T cells. Total CD4⁺ T cell counts are lower, with a reduction of naï¿½ve CD44^lo T cells occurring as mice age. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	A	G	1: 93,154,599	L266P	probably damaging	Het
Acr	A	G	15: 89,573,962	Y282C	probably damaging	Het
Alkbh4	A	G	5: 136,140,269	R136G	probably damaging	Het
Bptf	C	A	11: 107,047,340	E2*	probably null	Het
Cse1l	T	A	2: 166,939,913	F659Y	probably damaging	Het
Ctrc	A	T	4: 141,840,360	L144Q	probably damaging	Het
Elmo1	A	G	13: 20,286,732	I265V	probably benign	Het
Erich3	T	C	3: 154,713,916	S19P	probably benign	Het
Hmcn1	A	T	1: 150,664,878	C2893*	probably null	Het
Itpkb	T	C	1: 180,332,494	S62P	probably damaging	Het
Lig3	T	A	11: 82,792,076	C501S	probably benign	Het
Nrxn1	C	T	17: 91,088,536	R64H	possibly damaging	Het
Ogfod2	T	G	5: 124,114,883	C319G	probably damaging	Het
Olfr1474	A	G	19: 13,471,422	I109V	probably benign	Het
Olfr201	T	C	16: 59,269,109	N186S	probably benign	Het
Olfr555	A	T	7: 102,659,034	D71V	probably damaging	Het
Olfr827	A	G	10: 130,210,860	V90A	probably benign	Het
Pabpc6	C	A	17: 9,669,373	R83L	probably damaging	Het
Pcdhgb2	A	T	18: 37,690,634	Q226L	probably benign	Het
Pole	A	T	5: 110,312,734	I1127F	probably damaging	Het
Psg22	A	T	7: 18,719,746	Q161L	possibly damaging	Het
Slc17a7	A	T	7: 45,168,788	T46S	probably benign	Het
Smad4	A	G	18: 73,641,810	S473P	probably damaging	Het
Snap47	T	A	11: 59,438,354	T41S	probably benign	Het
Snx21	T	C	2: 164,786,737	L100P	probably benign	Het
Stc1	T	A	14: 69,038,395	N212K	probably benign	Het
Stk32a	A	T	18: 43,315,144	N396I	possibly damaging	Het
Stox2	G	A	8: 47,186,477	P894L	probably benign	Het
Trav16d-dv11	A	G	14: 53,047,287	M1V	probably null	Het
Trim33	T	C	3: 103,311,515		probably null	Het
Tyrp1	T	C	4: 80,840,670	V260A	probably benign	Het
Ush2a	T	C	1: 188,911,064	Y4208H	probably damaging	Het
Vmn1r25	T	A	6: 57,979,080	K75*	probably null	Het
Vmn2r117	T	A	17: 23,479,407	N64I	possibly damaging	Het
Wdfy4	C	T	14: 32,973,535		probably null	Het
Wnt8a	A	T	18: 34,545,516	I128F	probably damaging	Het
Zc3h7b	C	A	15: 81,779,260	Y484*	probably null	Het
Zfp619	A	G	7: 39,535,221	K225R	probably benign	Het

Other mutations in Hnrnpll

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
thunder	APN	17	80053571	missense	probably damaging	1.00
IGL01989:Hnrnpll	APN	17	80038740	missense	probably benign	0.15
IGL02093:Hnrnpll	APN	17	80044504	missense	probably benign	0.00
IGL02141:Hnrnpll	APN	17	80050713	missense	probably benign	0.02
IGL02749:Hnrnpll	APN	17	80061991	start codon destroyed	probably null
IGL03213:Hnrnpll	APN	17	80034098	missense	probably damaging	1.00
Grell	UTSW	17	80034105	missense	probably damaging	1.00
Lindsley	UTSW	17	80049847	missense	probably damaging	1.00
R0477:Hnrnpll	UTSW	17	80061832	missense	unknown
R1599:Hnrnpll	UTSW	17	80053625	missense	unknown
R1700:Hnrnpll	UTSW	17	80034105	missense	probably benign	0.18
R1838:Hnrnpll	UTSW	17	80038623	missense	probably damaging	1.00
R1907:Hnrnpll	UTSW	17	80035329	critical splice donor site	probably null
R1978:Hnrnpll	UTSW	17	80044518	missense	probably benign	0.01
R2079:Hnrnpll	UTSW	17	80035377	missense	probably benign	0.01
R4061:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4062:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4064:Hnrnpll	UTSW	17	80032772	missense	probably benign	0.01
R4226:Hnrnpll	UTSW	17	80049805	critical splice donor site	probably null
R4625:Hnrnpll	UTSW	17	80050862	nonsense	probably null
R5175:Hnrnpll	UTSW	17	80034070	missense	possibly damaging	0.83
R5232:Hnrnpll	UTSW	17	80038678	missense	probably damaging	1.00
R5620:Hnrnpll	UTSW	17	80038622	missense	probably damaging	1.00
R5978:Hnrnpll	UTSW	17	80034191	missense	probably damaging	1.00
R6183:Hnrnpll	UTSW	17	80049876	missense	possibly damaging	0.46
R6374:Hnrnpll	UTSW	17	80049874	missense	possibly damaging	0.51
R7120:Hnrnpll	UTSW	17	80034057	missense	probably benign	0.01
R7429:Hnrnpll	UTSW	17	80049847	missense	probably damaging	1.00
R7430:Hnrnpll	UTSW	17	80049847	missense	probably damaging	1.00
R7576:Hnrnpll	UTSW	17	80044514	missense	possibly damaging	0.91
R8010:Hnrnpll	UTSW	17	80061956	missense	unknown
R8060:Hnrnpll	UTSW	17	80034105	missense	probably damaging	1.00
R8068:Hnrnpll	UTSW	17	80050852	missense	possibly damaging	0.80
R8381:Hnrnpll	UTSW	17	80030491	missense	probably damaging	1.00
R9378:Hnrnpll	UTSW	17	80061862	missense	unknown
R9488:Hnrnpll	UTSW	17	80061956	missense	unknown
Z1177:Hnrnpll	UTSW	17	80048610	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATTGCTGCTTTGGACCTTGC -3'
(R):5'- TGTTCCACGGTAGAACATAGAGC -3'

Sequencing Primer
(F):5'- TGGACCTTGCTCTTTATACTGG -3'
(R):5'- TTTCCAATGCTATCCCAAAAGTC -3'

Posted On

2020-01-23