Incidental Mutation 'R8001:Hnrnpll'
ID 616377
Institutional Source Beutler Lab
Gene Symbol Hnrnpll
Ensembl Gene ENSMUSG00000024095
Gene Name heterogeneous nuclear ribonucleoprotein L-like
Synonyms Hnrpll, 2510028H02Rik, 2810036L13Rik
MMRRC Submission 046041-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.874) question?
Stock # R8001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 80336916-80369697 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 80346152 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 370 (Q370*)
Ref Sequence ENSEMBL: ENSMUSP00000139372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061331] [ENSMUST00000184297] [ENSMUST00000184635]
AlphaFold Q921F4
Predicted Effect probably null
Transcript: ENSMUST00000061331
AA Change: Q370*
SMART Domains Protein: ENSMUSP00000058308
Gene: ENSMUSG00000024095
AA Change: Q370*

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184297
SMART Domains Protein: ENSMUSP00000139075
Gene: ENSMUSG00000024095

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184635
AA Change: Q370*
SMART Domains Protein: ENSMUSP00000139372
Gene: ENSMUSG00000024095
AA Change: Q370*

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a point mutation in a RNA recognition motif of the gene product have defects in the generation of alternative transcripts normally found in memory T cells. Total CD4+ T cell counts are lower, with a reduction of na�ve CD44lo T cells occurring as mice age. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acr A G 15: 89,458,165 (GRCm39) Y282C probably damaging Het
Alkbh4 A G 5: 136,169,123 (GRCm39) R136G probably damaging Het
Bptf C A 11: 106,938,166 (GRCm39) E2* probably null Het
Cse1l T A 2: 166,781,833 (GRCm39) F659Y probably damaging Het
Ctrc A T 4: 141,567,671 (GRCm39) L144Q probably damaging Het
Elmo1 A G 13: 20,470,902 (GRCm39) I265V probably benign Het
Erich3 T C 3: 154,419,553 (GRCm39) S19P probably benign Het
Hmcn1 A T 1: 150,540,629 (GRCm39) C2893* probably null Het
Itpkb T C 1: 180,160,059 (GRCm39) S62P probably damaging Het
Lig3 T A 11: 82,682,902 (GRCm39) C501S probably benign Het
Mab21l4 A G 1: 93,082,321 (GRCm39) L266P probably damaging Het
Nrxn1 C T 17: 91,395,964 (GRCm39) R64H possibly damaging Het
Ogfod2 T G 5: 124,252,946 (GRCm39) C319G probably damaging Het
Or51h1 A T 7: 102,308,241 (GRCm39) D71V probably damaging Het
Or5ac19 T C 16: 59,089,472 (GRCm39) N186S probably benign Het
Or5b118 A G 19: 13,448,786 (GRCm39) I109V probably benign Het
Or9k7 A G 10: 130,046,729 (GRCm39) V90A probably benign Het
Pabpc6 C A 17: 9,888,302 (GRCm39) R83L probably damaging Het
Pcdhgb2 A T 18: 37,823,687 (GRCm39) Q226L probably benign Het
Pole A T 5: 110,460,600 (GRCm39) I1127F probably damaging Het
Psg22 A T 7: 18,453,671 (GRCm39) Q161L possibly damaging Het
Slc17a7 A T 7: 44,818,212 (GRCm39) T46S probably benign Het
Smad4 A G 18: 73,774,881 (GRCm39) S473P probably damaging Het
Snap47 T A 11: 59,329,180 (GRCm39) T41S probably benign Het
Snx21 T C 2: 164,628,657 (GRCm39) L100P probably benign Het
Stc1 T A 14: 69,275,844 (GRCm39) N212K probably benign Het
Stk32a A T 18: 43,448,209 (GRCm39) N396I possibly damaging Het
Stox2 G A 8: 47,639,512 (GRCm39) P894L probably benign Het
Trav16d-dv11 A G 14: 53,284,744 (GRCm39) M1V probably null Het
Trim33 T C 3: 103,218,831 (GRCm39) probably null Het
Tyrp1 T C 4: 80,758,907 (GRCm39) V260A probably benign Het
Ush2a T C 1: 188,643,261 (GRCm39) Y4208H probably damaging Het
Vmn1r25 T A 6: 57,956,065 (GRCm39) K75* probably null Het
Vmn2r117 T A 17: 23,698,381 (GRCm39) N64I possibly damaging Het
Wdfy4 C T 14: 32,695,492 (GRCm39) probably null Het
Wnt8a A T 18: 34,678,569 (GRCm39) I128F probably damaging Het
Zc3h7b C A 15: 81,663,461 (GRCm39) Y484* probably null Het
Zfp619 A G 7: 39,184,645 (GRCm39) K225R probably benign Het
Other mutations in Hnrnpll
AlleleSourceChrCoordTypePredicted EffectPPH Score
thunder APN 17 80,361,000 (GRCm39) missense probably damaging 1.00
IGL01989:Hnrnpll APN 17 80,346,169 (GRCm39) missense probably benign 0.15
IGL02093:Hnrnpll APN 17 80,351,933 (GRCm39) missense probably benign 0.00
IGL02141:Hnrnpll APN 17 80,358,142 (GRCm39) missense probably benign 0.02
IGL02749:Hnrnpll APN 17 80,369,420 (GRCm39) start codon destroyed probably null
IGL03213:Hnrnpll APN 17 80,341,527 (GRCm39) missense probably damaging 1.00
Grell UTSW 17 80,341,534 (GRCm39) missense probably damaging 1.00
Lindsley UTSW 17 80,357,276 (GRCm39) missense probably damaging 1.00
R0477:Hnrnpll UTSW 17 80,369,261 (GRCm39) missense unknown
R1599:Hnrnpll UTSW 17 80,361,054 (GRCm39) missense unknown
R1700:Hnrnpll UTSW 17 80,341,534 (GRCm39) missense probably benign 0.18
R1838:Hnrnpll UTSW 17 80,346,052 (GRCm39) missense probably damaging 1.00
R1907:Hnrnpll UTSW 17 80,342,758 (GRCm39) critical splice donor site probably null
R1978:Hnrnpll UTSW 17 80,351,947 (GRCm39) missense probably benign 0.01
R2079:Hnrnpll UTSW 17 80,342,806 (GRCm39) missense probably benign 0.01
R4061:Hnrnpll UTSW 17 80,340,201 (GRCm39) missense probably benign 0.01
R4062:Hnrnpll UTSW 17 80,340,201 (GRCm39) missense probably benign 0.01
R4064:Hnrnpll UTSW 17 80,340,201 (GRCm39) missense probably benign 0.01
R4226:Hnrnpll UTSW 17 80,357,234 (GRCm39) critical splice donor site probably null
R4625:Hnrnpll UTSW 17 80,358,291 (GRCm39) nonsense probably null
R5175:Hnrnpll UTSW 17 80,341,499 (GRCm39) missense possibly damaging 0.83
R5232:Hnrnpll UTSW 17 80,346,107 (GRCm39) missense probably damaging 1.00
R5620:Hnrnpll UTSW 17 80,346,051 (GRCm39) missense probably damaging 1.00
R5978:Hnrnpll UTSW 17 80,341,620 (GRCm39) missense probably damaging 1.00
R6183:Hnrnpll UTSW 17 80,357,305 (GRCm39) missense possibly damaging 0.46
R6374:Hnrnpll UTSW 17 80,357,303 (GRCm39) missense possibly damaging 0.51
R7120:Hnrnpll UTSW 17 80,341,486 (GRCm39) missense probably benign 0.01
R7429:Hnrnpll UTSW 17 80,357,276 (GRCm39) missense probably damaging 1.00
R7430:Hnrnpll UTSW 17 80,357,276 (GRCm39) missense probably damaging 1.00
R7576:Hnrnpll UTSW 17 80,351,943 (GRCm39) missense possibly damaging 0.91
R8010:Hnrnpll UTSW 17 80,369,385 (GRCm39) missense unknown
R8060:Hnrnpll UTSW 17 80,341,534 (GRCm39) missense probably damaging 1.00
R8068:Hnrnpll UTSW 17 80,358,281 (GRCm39) missense possibly damaging 0.80
R8381:Hnrnpll UTSW 17 80,337,920 (GRCm39) missense probably damaging 1.00
R9378:Hnrnpll UTSW 17 80,369,291 (GRCm39) missense unknown
R9488:Hnrnpll UTSW 17 80,369,385 (GRCm39) missense unknown
Z1177:Hnrnpll UTSW 17 80,356,039 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTGCTGCTTTGGACCTTGC -3'
(R):5'- TGTTCCACGGTAGAACATAGAGC -3'

Sequencing Primer
(F):5'- TGGACCTTGCTCTTTATACTGG -3'
(R):5'- TTTCCAATGCTATCCCAAAAGTC -3'
Posted On 2020-01-23