Incidental Mutation 'R8001:Wnt8a'
ID 616379
Institutional Source Beutler Lab
Gene Symbol Wnt8a
Ensembl Gene ENSMUSG00000012282
Gene Name wingless-type MMTV integration site family, member 8A
Synonyms Stra11
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 34542313-34548273 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34545516 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 128 (I128F)
Ref Sequence ENSEMBL: ENSMUSP00000012426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012426]
AlphaFold Q64527
Predicted Effect probably damaging
Transcript: ENSMUST00000012426
AA Change: I128F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000012426
Gene: ENSMUSG00000012282
AA Change: I128F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
WNT1 21 337 2.26e-155 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family, and may be implicated in development of early embryos as well as germ cell tumors. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A G 1: 93,154,599 L266P probably damaging Het
Acr A G 15: 89,573,962 Y282C probably damaging Het
Alkbh4 A G 5: 136,140,269 R136G probably damaging Het
Bptf C A 11: 107,047,340 E2* probably null Het
Cse1l T A 2: 166,939,913 F659Y probably damaging Het
Ctrc A T 4: 141,840,360 L144Q probably damaging Het
Elmo1 A G 13: 20,286,732 I265V probably benign Het
Erich3 T C 3: 154,713,916 S19P probably benign Het
Hmcn1 A T 1: 150,664,878 C2893* probably null Het
Hnrnpll G A 17: 80,038,723 Q370* probably null Het
Itpkb T C 1: 180,332,494 S62P probably damaging Het
Lig3 T A 11: 82,792,076 C501S probably benign Het
Nrxn1 C T 17: 91,088,536 R64H possibly damaging Het
Ogfod2 T G 5: 124,114,883 C319G probably damaging Het
Olfr1474 A G 19: 13,471,422 I109V probably benign Het
Olfr201 T C 16: 59,269,109 N186S probably benign Het
Olfr555 A T 7: 102,659,034 D71V probably damaging Het
Olfr827 A G 10: 130,210,860 V90A probably benign Het
Pabpc6 C A 17: 9,669,373 R83L probably damaging Het
Pcdhgb2 A T 18: 37,690,634 Q226L probably benign Het
Pole A T 5: 110,312,734 I1127F probably damaging Het
Psg22 A T 7: 18,719,746 Q161L possibly damaging Het
Slc17a7 A T 7: 45,168,788 T46S probably benign Het
Smad4 A G 18: 73,641,810 S473P probably damaging Het
Snap47 T A 11: 59,438,354 T41S probably benign Het
Snx21 T C 2: 164,786,737 L100P probably benign Het
Stc1 T A 14: 69,038,395 N212K probably benign Het
Stk32a A T 18: 43,315,144 N396I possibly damaging Het
Stox2 G A 8: 47,186,477 P894L probably benign Het
Trav16d-dv11 A G 14: 53,047,287 M1V probably null Het
Trim33 T C 3: 103,311,515 probably null Het
Tyrp1 T C 4: 80,840,670 V260A probably benign Het
Ush2a T C 1: 188,911,064 Y4208H probably damaging Het
Vmn1r25 T A 6: 57,979,080 K75* probably null Het
Vmn2r117 T A 17: 23,479,407 N64I possibly damaging Het
Wdfy4 C T 14: 32,973,535 probably null Het
Zc3h7b C A 15: 81,779,260 Y484* probably null Het
Zfp619 A G 7: 39,535,221 K225R probably benign Het
Other mutations in Wnt8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Wnt8a APN 18 34544793 missense probably damaging 0.98
IGL01823:Wnt8a APN 18 34544793 missense possibly damaging 0.85
IGL02964:Wnt8a APN 18 34542421 missense possibly damaging 0.86
PIT4486001:Wnt8a UTSW 18 34547583 missense probably damaging 1.00
R0496:Wnt8a UTSW 18 34544847 missense probably damaging 1.00
R0646:Wnt8a UTSW 18 34547565 missense probably benign 0.02
R1813:Wnt8a UTSW 18 34542369 start codon destroyed probably null 0.89
R1990:Wnt8a UTSW 18 34544884 missense probably damaging 1.00
R1991:Wnt8a UTSW 18 34544884 missense probably damaging 1.00
R1992:Wnt8a UTSW 18 34544884 missense probably damaging 1.00
R4927:Wnt8a UTSW 18 34547472 missense probably damaging 1.00
R5085:Wnt8a UTSW 18 34545603 nonsense probably null
R6161:Wnt8a UTSW 18 34545546 missense possibly damaging 0.86
R7719:Wnt8a UTSW 18 34547535 missense probably damaging 1.00
R9022:Wnt8a UTSW 18 34547245 missense probably damaging 1.00
R9617:Wnt8a UTSW 18 34547110 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCACCCAGGTTATCACAC -3'
(R):5'- TGAGGAGCTGTTGTCAAAACTG -3'

Sequencing Primer
(F):5'- CTTCCTGTGGGTAGAGAGAACC -3'
(R):5'- TGTCAAAACTGGGTGACTCC -3'
Posted On 2020-01-23