Incidental Mutation 'R8001:Stk32a'
ID616381
Institutional Source Beutler Lab
Gene Symbol Stk32a
Ensembl Gene ENSMUSG00000039954
Gene Nameserine/threonine kinase 32A
SynonymsYANK1, A930015B13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8001 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location43207697-43317481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43315144 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 396 (N396I)
Ref Sequence ENSEMBL: ENSMUSP00000038471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045477]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045477
AA Change: N396I

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038471
Gene: ENSMUSG00000039954
AA Change: N396I

DomainStartEndE-ValueType
S_TKc 23 281 9.58e-85 SMART
low complexity region 318 339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A G 1: 93,154,599 L266P probably damaging Het
Acr A G 15: 89,573,962 Y282C probably damaging Het
Alkbh4 A G 5: 136,140,269 R136G probably damaging Het
Bptf C A 11: 107,047,340 E2* probably null Het
Cse1l T A 2: 166,939,913 F659Y probably damaging Het
Ctrc A T 4: 141,840,360 L144Q probably damaging Het
Elmo1 A G 13: 20,286,732 I265V probably benign Het
Erich3 T C 3: 154,713,916 S19P probably benign Het
Hmcn1 A T 1: 150,664,878 C2893* probably null Het
Hnrnpll G A 17: 80,038,723 Q370* probably null Het
Itpkb T C 1: 180,332,494 S62P probably damaging Het
Lig3 T A 11: 82,792,076 C501S probably benign Het
Nrxn1 C T 17: 91,088,536 R64H possibly damaging Het
Ogfod2 T G 5: 124,114,883 C319G probably damaging Het
Olfr1474 A G 19: 13,471,422 I109V probably benign Het
Olfr201 T C 16: 59,269,109 N186S probably benign Het
Olfr555 A T 7: 102,659,034 D71V probably damaging Het
Olfr827 A G 10: 130,210,860 V90A probably benign Het
Pabpc6 C A 17: 9,669,373 R83L probably damaging Het
Pcdhgb2 A T 18: 37,690,634 Q226L probably benign Het
Pole A T 5: 110,312,734 I1127F probably damaging Het
Psg22 A T 7: 18,719,746 Q161L possibly damaging Het
Slc17a7 A T 7: 45,168,788 T46S probably benign Het
Smad4 A G 18: 73,641,810 S473P probably damaging Het
Snap47 T A 11: 59,438,354 T41S probably benign Het
Snx21 T C 2: 164,786,737 L100P probably benign Het
Stc1 T A 14: 69,038,395 N212K probably benign Het
Stox2 G A 8: 47,186,477 P894L probably benign Het
Trav16d-dv11 A G 14: 53,047,287 M1V probably null Het
Trim33 T C 3: 103,311,515 probably null Het
Tyrp1 T C 4: 80,840,670 V260A probably benign Het
Ush2a T C 1: 188,911,064 Y4208H probably damaging Het
Vmn1r25 T A 6: 57,979,080 K75* probably null Het
Vmn2r117 T A 17: 23,479,407 N64I possibly damaging Het
Wdfy4 C T 14: 32,973,535 probably null Het
Wnt8a A T 18: 34,545,516 I128F probably damaging Het
Zc3h7b C A 15: 81,779,260 Y484* probably null Het
Zfp619 A G 7: 39,535,221 K225R probably benign Het
Other mutations in Stk32a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Stk32a APN 18 43310445 missense possibly damaging 0.46
IGL00704:Stk32a APN 18 43261249 missense probably damaging 1.00
IGL00813:Stk32a APN 18 43310520 missense probably benign 0.10
IGL02121:Stk32a APN 18 43313507 missense probably benign
IGL02407:Stk32a APN 18 43297511 missense probably benign 0.00
IGL02957:Stk32a APN 18 43311992 missense probably benign
R0004:Stk32a UTSW 18 43305056 missense probably damaging 1.00
R0047:Stk32a UTSW 18 43313378 splice site probably benign
R0047:Stk32a UTSW 18 43313378 splice site probably benign
R0288:Stk32a UTSW 18 43304995 splice site probably null
R0330:Stk32a UTSW 18 43313501 missense probably benign 0.15
R1337:Stk32a UTSW 18 43261349 missense probably benign 0.00
R1559:Stk32a UTSW 18 43243084 missense probably benign 0.32
R1695:Stk32a UTSW 18 43313420 nonsense probably null
R1874:Stk32a UTSW 18 43261316 missense probably damaging 1.00
R1954:Stk32a UTSW 18 43212025 missense probably benign 0.45
R4529:Stk32a UTSW 18 43242979 missense possibly damaging 0.83
R4980:Stk32a UTSW 18 43314048 missense probably benign 0.01
R5124:Stk32a UTSW 18 43305017 missense probably benign 0.00
R5751:Stk32a UTSW 18 43305020 missense possibly damaging 0.74
R5822:Stk32a UTSW 18 43313487 missense probably benign 0.00
R5863:Stk32a UTSW 18 43315144 missense probably benign 0.00
R6167:Stk32a UTSW 18 43313409 missense probably damaging 1.00
R6355:Stk32a UTSW 18 43297594 splice site probably null
R6731:Stk32a UTSW 18 43305078 missense probably damaging 1.00
R7162:Stk32a UTSW 18 43297584 nonsense probably null
R8022:Stk32a UTSW 18 43315101 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCTATGACTTGTAAAAGCTGTCTTAG -3'
(R):5'- TCTACCTTCCAAGCGGTGAAC -3'

Sequencing Primer
(F):5'- GAATGAACTCAGCAGCTTGTATCC -3'
(R):5'- TCACAGAGTCAATGCGTGCTG -3'
Posted On2020-01-23