Incidental Mutation 'R8002:Tas2r114'
ID 616403
Institutional Source Beutler Lab
Gene Symbol Tas2r114
Ensembl Gene ENSMUSG00000063478
Gene Name taste receptor, type 2, member 114
Synonyms mt2r46, mGR14, T2R14, Tas2r14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R8002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 131689134-131690063 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 131689139 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 309 (T309A)
Ref Sequence ENSEMBL: ENSMUSP00000079453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]
AlphaFold Q7M722
Predicted Effect probably benign
Transcript: ENSMUST00000053652
SMART Domains Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 9.4e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072404
SMART Domains Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.3e-102 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080619
AA Change: T309A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478
AA Change: T309A

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.1e-104 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 C T 7: 119,573,257 R133C possibly damaging Het
Adgrf4 T C 17: 42,667,792 E220G probably benign Het
Alx3 T A 3: 107,600,739 L188* probably null Het
Arhgef2 A T 3: 88,646,810 I969F probably damaging Het
Atf6 A G 1: 170,819,254 V350A probably benign Het
Atp1a3 C A 7: 25,000,671 G88V probably damaging Het
Brd8 T C 18: 34,608,556 T360A probably benign Het
Casp1 C A 9: 5,303,164 T206K possibly damaging Het
Ccdc150 A G 1: 54,272,497 E214G probably damaging Het
Ccdc81 T C 7: 89,876,135 E477G probably benign Het
Celsr2 G T 3: 108,403,969 R1409S probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Cpne3 A T 4: 19,528,232 F342I probably damaging Het
Crot A C 5: 8,993,599 S8A probably benign Het
Cyp11b2 T C 15: 74,856,032 H67R probably damaging Het
Dnah1 A T 14: 31,298,722 L1230H probably damaging Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Gabrg3 T C 7: 56,734,968 T282A possibly damaging Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gm13199 A G 2: 5,862,647 S13P unknown Het
Gnptab A T 10: 88,440,268 D1139V probably benign Het
Jtb T C 3: 90,233,944 S76P probably benign Het
Klk1b27 T A 7: 44,056,021 D172E probably benign Het
Lpcat4 G A 2: 112,244,354 V307I probably benign Het
Ltn1 A C 16: 87,415,947 S575R probably benign Het
Map3k13 A G 16: 21,905,128 T287A probably benign Het
Marco T G 1: 120,494,780 I58L probably benign Het
Nadk G T 4: 155,577,198 probably null Het
Olfr746 A T 14: 50,653,857 I207F probably damaging Het
Otof G A 5: 30,380,610 T1215I probably benign Het
Pigw A T 11: 84,878,423 C27S probably benign Het
Pla2g10 A T 16: 13,725,048 M125K unknown Het
Rfx4 A C 10: 84,840,857 M204L probably damaging Het
Sept1 T C 7: 127,215,902 D209G probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc26a4 T C 12: 31,547,970 D159G probably benign Het
Sptbn4 C A 7: 27,417,992 S444I possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stard6 T A 18: 70,500,526 D201E possibly damaging Het
Tdrd6 C A 17: 43,629,819 A113S probably damaging Het
Tigd2 T G 6: 59,210,509 N120K probably damaging Het
Tomm70a A G 16: 57,136,734 N224S probably damaging Het
Tspo T C 15: 83,571,439 V9A probably benign Het
Vmn1r21 T A 6: 57,844,214 I82L probably benign Het
Vmn2r103 T A 17: 19,799,249 C532S probably damaging Het
Vmn2r76 T C 7: 86,230,063 N343S probably benign Het
Wdr62 T C 7: 30,252,360 K665E probably damaging Het
Xpc T A 6: 91,492,305 N820I probably damaging Het
Zfp418 A G 7: 7,181,874 T279A probably benign Het
Other mutations in Tas2r114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Tas2r114 APN 6 131689701 nonsense probably null
IGL02971:Tas2r114 APN 6 131689280 missense probably benign 0.00
R0561:Tas2r114 UTSW 6 131689795 missense probably benign 0.30
R3034:Tas2r114 UTSW 6 131689648 missense probably benign 0.15
R3687:Tas2r114 UTSW 6 131689268 missense probably benign 0.25
R4411:Tas2r114 UTSW 6 131689622 missense probably benign 0.06
R4826:Tas2r114 UTSW 6 131689837 missense probably damaging 0.99
R4889:Tas2r114 UTSW 6 131689795 missense probably damaging 0.96
R5084:Tas2r114 UTSW 6 131689288 nonsense probably null
R5258:Tas2r114 UTSW 6 131689541 missense probably benign 0.03
R6038:Tas2r114 UTSW 6 131689481 missense possibly damaging 0.89
R6038:Tas2r114 UTSW 6 131689481 missense possibly damaging 0.89
R6499:Tas2r114 UTSW 6 131689136 makesense probably null
R7164:Tas2r114 UTSW 6 131689765 missense possibly damaging 0.74
R7276:Tas2r114 UTSW 6 131689347 missense probably damaging 0.96
R7745:Tas2r114 UTSW 6 131689438 missense probably damaging 1.00
R7851:Tas2r114 UTSW 6 131689925 missense probably damaging 1.00
R8901:Tas2r114 UTSW 6 131689951 missense probably damaging 0.99
R9297:Tas2r114 UTSW 6 131689324 missense probably damaging 0.96
R9380:Tas2r114 UTSW 6 131689418 missense probably benign 0.00
R9402:Tas2r114 UTSW 6 131689931 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GACTAACGAGTTGGAGACTGACTG -3'
(R):5'- CTGTTAATCCCAGAAAGCAACTTG -3'

Sequencing Primer
(F):5'- CTGAACAAATTAACCTGTACATGGG -3'
(R):5'- CCCAGAAAGCAACTTGTTATTCATG -3'
Posted On 2020-01-23