Mutagenetix > Incidental Mutations

Incidental Mutation 'R8002:Tas2r114'

616403

Institutional Source

Beutler Lab

Gene Symbol

Tas2r114

Ensembl Gene

ENSMUSG00000063478

Gene Name

taste receptor, type 2, member 114

Synonyms

mt2r46, mGR14, T2R14, Tas2r14

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R8002 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

131689134-131690063 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 131689139 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 309 (T309A)

Ref Sequence

ENSEMBL: ENSMUSP00000079453 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]

AlphaFold

Q7M722

Predicted Effect

probably benign
Transcript: ENSMUST00000053652

SMART Domains

Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153

Domain	Start	End	E-Value	Type
Pfam:TAS2R	1	298	9.4e-109	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000072404

SMART Domains

Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977

Domain	Start	End	E-Value	Type
Pfam:TAS2R	1	298	8.3e-102	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000080619
AA Change: T309A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478
AA Change: T309A

Domain	Start	End	E-Value	Type
Pfam:TAS2R	1	298	8.1e-104	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	C	T	7: 119,573,257	R133C	possibly damaging	Het
Adgrf4	T	C	17: 42,667,792	E220G	probably benign	Het
Alx3	T	A	3: 107,600,739	L188*	probably null	Het
Arhgef2	A	T	3: 88,646,810	I969F	probably damaging	Het
Atf6	A	G	1: 170,819,254	V350A	probably benign	Het
Atp1a3	C	A	7: 25,000,671	G88V	probably damaging	Het
Brd8	T	C	18: 34,608,556	T360A	probably benign	Het
Casp1	C	A	9: 5,303,164	T206K	possibly damaging	Het
Ccdc150	A	G	1: 54,272,497	E214G	probably damaging	Het
Ccdc81	T	C	7: 89,876,135	E477G	probably benign	Het
Celsr2	G	T	3: 108,403,969	R1409S	probably damaging	Het
Chd6	T	C	2: 160,990,321	D977G	probably damaging	Het
Cpne3	A	T	4: 19,528,232	F342I	probably damaging	Het
Crot	A	C	5: 8,993,599	S8A	probably benign	Het
Cyp11b2	T	C	15: 74,856,032	H67R	probably damaging	Het
Dnah1	A	T	14: 31,298,722	L1230H	probably damaging	Het
Dqx1	G	A	6: 83,058,577	D24N	probably damaging	Het
Gabrg3	T	C	7: 56,734,968	T282A	possibly damaging	Het
Gm10093	T	C	17: 78,492,287	S236P	probably damaging	Het
Gm13199	A	G	2: 5,862,647	S13P	unknown	Het
Gnptab	A	T	10: 88,440,268	D1139V	probably benign	Het
Jtb	T	C	3: 90,233,944	S76P	probably benign	Het
Klk1b27	T	A	7: 44,056,021	D172E	probably benign	Het
Lpcat4	G	A	2: 112,244,354	V307I	probably benign	Het
Ltn1	A	C	16: 87,415,947	S575R	probably benign	Het
Map3k13	A	G	16: 21,905,128	T287A	probably benign	Het
Marco	T	G	1: 120,494,780	I58L	probably benign	Het
Nadk	G	T	4: 155,577,198		probably null	Het
Olfr746	A	T	14: 50,653,857	I207F	probably damaging	Het
Otof	G	A	5: 30,380,610	T1215I	probably benign	Het
Pigw	A	T	11: 84,878,423	C27S	probably benign	Het
Pla2g10	A	T	16: 13,725,048	M125K	unknown	Het
Rfx4	A	C	10: 84,840,857	M204L	probably damaging	Het
Sept1	T	C	7: 127,215,902	D209G	probably damaging	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc26a4	T	C	12: 31,547,970	D159G	probably benign	Het
Sptbn4	C	A	7: 27,417,992	S444I	possibly damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Stard6	T	A	18: 70,500,526	D201E	possibly damaging	Het
Tdrd6	C	A	17: 43,629,819	A113S	probably damaging	Het
Tigd2	T	G	6: 59,210,509	N120K	probably damaging	Het
Tomm70a	A	G	16: 57,136,734	N224S	probably damaging	Het
Tspo	T	C	15: 83,571,439	V9A	probably benign	Het
Vmn1r21	T	A	6: 57,844,214	I82L	probably benign	Het
Vmn2r103	T	A	17: 19,799,249	C532S	probably damaging	Het
Vmn2r76	T	C	7: 86,230,063	N343S	probably benign	Het
Wdr62	T	C	7: 30,252,360	K665E	probably damaging	Het
Xpc	T	A	6: 91,492,305	N820I	probably damaging	Het
Zfp418	A	G	7: 7,181,874	T279A	probably benign	Het

Other mutations in Tas2r114

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01777:Tas2r114	APN	6	131689701	nonsense	probably null
IGL02971:Tas2r114	APN	6	131689280	missense	probably benign	0.00
R0561:Tas2r114	UTSW	6	131689795	missense	probably benign	0.30
R3034:Tas2r114	UTSW	6	131689648	missense	probably benign	0.15
R3687:Tas2r114	UTSW	6	131689268	missense	probably benign	0.25
R4411:Tas2r114	UTSW	6	131689622	missense	probably benign	0.06
R4826:Tas2r114	UTSW	6	131689837	missense	probably damaging	0.99
R4889:Tas2r114	UTSW	6	131689795	missense	probably damaging	0.96
R5084:Tas2r114	UTSW	6	131689288	nonsense	probably null
R5258:Tas2r114	UTSW	6	131689541	missense	probably benign	0.03
R6038:Tas2r114	UTSW	6	131689481	missense	possibly damaging	0.89
R6038:Tas2r114	UTSW	6	131689481	missense	possibly damaging	0.89
R6499:Tas2r114	UTSW	6	131689136	makesense	probably null
R7164:Tas2r114	UTSW	6	131689765	missense	possibly damaging	0.74
R7276:Tas2r114	UTSW	6	131689347	missense	probably damaging	0.96
R7745:Tas2r114	UTSW	6	131689438	missense	probably damaging	1.00
R7851:Tas2r114	UTSW	6	131689925	missense	probably damaging	1.00
R8901:Tas2r114	UTSW	6	131689951	missense	probably damaging	0.99
R9297:Tas2r114	UTSW	6	131689324	missense	probably damaging	0.96
R9380:Tas2r114	UTSW	6	131689418	missense	probably benign	0.00
R9402:Tas2r114	UTSW	6	131689931	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- GACTAACGAGTTGGAGACTGACTG -3'
(R):5'- CTGTTAATCCCAGAAAGCAACTTG -3'

Sequencing Primer
(F):5'- CTGAACAAATTAACCTGTACATGGG -3'
(R):5'- CCCAGAAAGCAACTTGTTATTCATG -3'

Posted On

2020-01-23