Incidental Mutation 'R8002:Atp1a3'
ID 616405
Institutional Source Beutler Lab
Gene Symbol Atp1a3
Ensembl Gene ENSMUSG00000040907
Gene Name ATPase, Na+/K+ transporting, alpha 3 polypeptide
Synonyms Atpa-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 24978167-25005958 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 25000671 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 88 (G88V)
Ref Sequence ENSEMBL: ENSMUSP00000079691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080882] [ENSMUST00000102858] [ENSMUST00000196684]
AlphaFold Q6PIC6
Predicted Effect probably damaging
Transcript: ENSMUST00000080882
AA Change: G88V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079691
Gene: ENSMUSG00000040907
AA Change: G88V

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Cation_ATPase_N 32 106 2.41e-22 SMART
Pfam:E1-E2_ATPase 125 356 6.3e-64 PFAM
Pfam:Hydrolase 360 719 2.6e-32 PFAM
Pfam:HAD 363 716 4.7e-18 PFAM
Pfam:Hydrolase_like2 416 511 5.7e-26 PFAM
Pfam:Cation_ATPase_C 789 998 3.5e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102858
AA Change: G88V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099922
Gene: ENSMUSG00000040907
AA Change: G88V

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Cation_ATPase_N 32 106 2.41e-22 SMART
Pfam:E1-E2_ATPase 124 355 4.6e-60 PFAM
Pfam:Hydrolase 360 719 5.7e-20 PFAM
Pfam:HAD 363 716 4.5e-19 PFAM
Pfam:Cation_ATPase 416 511 5.1e-25 PFAM
Pfam:Cation_ATPase_C 789 998 1.4e-46 PFAM
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196684
AA Change: G101V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143735
Gene: ENSMUSG00000040907
AA Change: G101V

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Cation_ATPase_N 45 119 1.9e-26 SMART
Pfam:E1-E2_ATPase 137 368 4e-58 PFAM
Pfam:Hydrolase 373 732 3.8e-18 PFAM
Pfam:HAD 376 729 3.8e-17 PFAM
Pfam:Cation_ATPase 429 524 5.2e-23 PFAM
Pfam:Cation_ATPase_C 802 1011 2.5e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 3 subunit. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display neonatal lethality. Heterozygous mice display hyperactivity, increased activity in responses to methamphetamine, and impaired spatial learning. Mice heterozygous for an ENU mutation exhibit convulsive and vestibular stress induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 C T 7: 119,573,257 R133C possibly damaging Het
Adgrf4 T C 17: 42,667,792 E220G probably benign Het
Alx3 T A 3: 107,600,739 L188* probably null Het
Arhgef2 A T 3: 88,646,810 I969F probably damaging Het
Atf6 A G 1: 170,819,254 V350A probably benign Het
Brd8 T C 18: 34,608,556 T360A probably benign Het
Casp1 C A 9: 5,303,164 T206K possibly damaging Het
Ccdc150 A G 1: 54,272,497 E214G probably damaging Het
Ccdc81 T C 7: 89,876,135 E477G probably benign Het
Celsr2 G T 3: 108,403,969 R1409S probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Cpne3 A T 4: 19,528,232 F342I probably damaging Het
Crot A C 5: 8,993,599 S8A probably benign Het
Cyp11b2 T C 15: 74,856,032 H67R probably damaging Het
Dnah1 A T 14: 31,298,722 L1230H probably damaging Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Gabrg3 T C 7: 56,734,968 T282A possibly damaging Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gm13199 A G 2: 5,862,647 S13P unknown Het
Gnptab A T 10: 88,440,268 D1139V probably benign Het
Jtb T C 3: 90,233,944 S76P probably benign Het
Klk1b27 T A 7: 44,056,021 D172E probably benign Het
Lpcat4 G A 2: 112,244,354 V307I probably benign Het
Ltn1 A C 16: 87,415,947 S575R probably benign Het
Map3k13 A G 16: 21,905,128 T287A probably benign Het
Marco T G 1: 120,494,780 I58L probably benign Het
Nadk G T 4: 155,577,198 probably null Het
Olfr746 A T 14: 50,653,857 I207F probably damaging Het
Otof G A 5: 30,380,610 T1215I probably benign Het
Pigw A T 11: 84,878,423 C27S probably benign Het
Pla2g10 A T 16: 13,725,048 M125K unknown Het
Rfx4 A C 10: 84,840,857 M204L probably damaging Het
Sept1 T C 7: 127,215,902 D209G probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc26a4 T C 12: 31,547,970 D159G probably benign Het
Sptbn4 C A 7: 27,417,992 S444I possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stard6 T A 18: 70,500,526 D201E possibly damaging Het
Tas2r114 T C 6: 131,689,139 T309A probably damaging Het
Tdrd6 C A 17: 43,629,819 A113S probably damaging Het
Tigd2 T G 6: 59,210,509 N120K probably damaging Het
Tomm70a A G 16: 57,136,734 N224S probably damaging Het
Tspo T C 15: 83,571,439 V9A probably benign Het
Vmn1r21 T A 6: 57,844,214 I82L probably benign Het
Vmn2r103 T A 17: 19,799,249 C532S probably damaging Het
Vmn2r76 T C 7: 86,230,063 N343S probably benign Het
Wdr62 T C 7: 30,252,360 K665E probably damaging Het
Xpc T A 6: 91,492,305 N820I probably damaging Het
Zfp418 A G 7: 7,181,874 T279A probably benign Het
Other mutations in Atp1a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02129:Atp1a3 APN 7 24997286 missense probably damaging 0.98
IGL02736:Atp1a3 APN 7 24980109 missense probably damaging 1.00
IGL02738:Atp1a3 APN 7 24990476 missense possibly damaging 0.86
IGL02806:Atp1a3 APN 7 24981872 missense probably damaging 1.00
borah UTSW 7 24994569 missense probably damaging 1.00
Clonic UTSW 7 24987985 missense probably benign 0.37
Littlewolf UTSW 7 24981791 missense probably damaging 1.00
R0003:Atp1a3 UTSW 7 24989564 splice site probably benign
R0254:Atp1a3 UTSW 7 24981512 splice site probably benign
R0420:Atp1a3 UTSW 7 24980627 missense probably benign
R0437:Atp1a3 UTSW 7 24998967 missense probably benign 0.36
R0666:Atp1a3 UTSW 7 24990549 missense probably benign 0.01
R0932:Atp1a3 UTSW 7 24987976 critical splice donor site probably null
R1586:Atp1a3 UTSW 7 24979383 missense probably damaging 0.97
R1981:Atp1a3 UTSW 7 25000975 missense probably benign 0.19
R2105:Atp1a3 UTSW 7 24989853 missense probably damaging 1.00
R3076:Atp1a3 UTSW 7 24980073 missense possibly damaging 0.48
R3110:Atp1a3 UTSW 7 24994694 missense probably damaging 1.00
R3112:Atp1a3 UTSW 7 24994694 missense probably damaging 1.00
R4223:Atp1a3 UTSW 7 25000930 missense probably benign 0.09
R4327:Atp1a3 UTSW 7 24987631 intron probably benign
R4598:Atp1a3 UTSW 7 24979341 missense probably damaging 0.99
R4626:Atp1a3 UTSW 7 24998768 missense possibly damaging 0.75
R4789:Atp1a3 UTSW 7 24998964 missense probably damaging 1.00
R4963:Atp1a3 UTSW 7 24994626 missense probably damaging 0.97
R5243:Atp1a3 UTSW 7 24994569 missense probably damaging 1.00
R5294:Atp1a3 UTSW 7 24988048 missense probably damaging 0.98
R5668:Atp1a3 UTSW 7 24978869 intron probably benign
R5704:Atp1a3 UTSW 7 24997311 missense probably damaging 0.98
R5870:Atp1a3 UTSW 7 24997578 missense probably benign 0.03
R5934:Atp1a3 UTSW 7 24978874 intron probably benign
R6183:Atp1a3 UTSW 7 24981752 missense probably damaging 1.00
R6492:Atp1a3 UTSW 7 24979304 missense probably damaging 1.00
R6996:Atp1a3 UTSW 7 24997626 missense probably damaging 1.00
R7165:Atp1a3 UTSW 7 24978965 missense probably benign 0.13
R7229:Atp1a3 UTSW 7 24987985 missense probably benign 0.37
R7239:Atp1a3 UTSW 7 25000704 missense probably damaging 1.00
R7301:Atp1a3 UTSW 7 24990515 missense probably benign 0.00
R7330:Atp1a3 UTSW 7 25001152 nonsense probably null
R7348:Atp1a3 UTSW 7 24978826 missense unknown
R7432:Atp1a3 UTSW 7 25005875 unclassified probably benign
R7490:Atp1a3 UTSW 7 24987470 missense probably damaging 1.00
R7556:Atp1a3 UTSW 7 24981566 missense probably benign 0.02
R7860:Atp1a3 UTSW 7 24981791 missense probably damaging 1.00
R7861:Atp1a3 UTSW 7 25001148 missense unknown
R7993:Atp1a3 UTSW 7 25000981 critical splice acceptor site probably null
R8010:Atp1a3 UTSW 7 24980645 missense possibly damaging 0.90
R8430:Atp1a3 UTSW 7 24999012 missense probably damaging 1.00
R8780:Atp1a3 UTSW 7 24981554 missense probably damaging 0.96
R8837:Atp1a3 UTSW 7 24978555 missense probably damaging 1.00
R9031:Atp1a3 UTSW 7 24989787 critical splice donor site probably null
R9220:Atp1a3 UTSW 7 24997200 nonsense probably null
R9259:Atp1a3 UTSW 7 24997531 missense probably damaging 1.00
Z1176:Atp1a3 UTSW 7 24998688 missense probably benign 0.00
Z1177:Atp1a3 UTSW 7 24980119 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGCAATTGTGACAGTTGGATG -3'
(R):5'- GCCGGAAATACAATACTGACTGC -3'

Sequencing Primer
(F):5'- CAATTGTGACAGTTGGATGATGGGAG -3'
(R):5'- AGGGCTCTGGGTACTCGAG -3'
Posted On 2020-01-23