Incidental Mutation 'R8002:Klk1b27'
ID616408
Institutional Source Beutler Lab
Gene Symbol Klk1b27
Ensembl Gene ENSMUSG00000063177
Gene Namekallikrein 1-related peptidase b27
SynonymsmGK-27, Klk27, Klk21l
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8002 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location44052290-44056712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44056021 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 172 (D172E)
Ref Sequence ENSEMBL: ENSMUSP00000078786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079859]
Predicted Effect probably benign
Transcript: ENSMUST00000079859
AA Change: D172E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000078786
Gene: ENSMUSG00000063177
AA Change: D172E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 255 1.87e-97 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 C T 7: 119,573,257 R133C possibly damaging Het
Adgrf4 T C 17: 42,667,792 E220G probably benign Het
Alx3 T A 3: 107,600,739 L188* probably null Het
Arhgef2 A T 3: 88,646,810 I969F probably damaging Het
Atf6 A G 1: 170,819,254 V350A probably benign Het
Atp1a3 C A 7: 25,000,671 G88V probably damaging Het
Brd8 T C 18: 34,608,556 T360A probably benign Het
Casp1 C A 9: 5,303,164 T206K possibly damaging Het
Ccdc150 A G 1: 54,272,497 E214G probably damaging Het
Ccdc81 T C 7: 89,876,135 E477G probably benign Het
Celsr2 G T 3: 108,403,969 R1409S probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Cpne3 A T 4: 19,528,232 F342I probably damaging Het
Crot A C 5: 8,993,599 S8A probably benign Het
Cyp11b2 T C 15: 74,856,032 H67R probably damaging Het
Dnah1 A T 14: 31,298,722 L1230H probably damaging Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Gabrg3 T C 7: 56,734,968 T282A possibly damaging Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gm13199 A G 2: 5,862,647 S13P unknown Het
Gnptab A T 10: 88,440,268 D1139V probably benign Het
Jtb T C 3: 90,233,944 S76P probably benign Het
Lpcat4 G A 2: 112,244,354 V307I probably benign Het
Ltn1 A C 16: 87,415,947 S575R probably benign Het
Map3k13 A G 16: 21,905,128 T287A probably benign Het
Marco T G 1: 120,494,780 I58L probably benign Het
Nadk G T 4: 155,577,198 probably null Het
Olfr746 A T 14: 50,653,857 I207F probably damaging Het
Otof G A 5: 30,380,610 T1215I probably benign Het
Pigw A T 11: 84,878,423 C27S probably benign Het
Pla2g10 A T 16: 13,725,048 M125K unknown Het
Rfx4 A C 10: 84,840,857 M204L probably damaging Het
Sept1 T C 7: 127,215,902 D209G probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc26a4 T C 12: 31,547,970 D159G probably benign Het
Sptbn4 C A 7: 27,417,992 S444I possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stard6 T A 18: 70,500,526 D201E possibly damaging Het
Tas2r114 T C 6: 131,689,139 T309A probably damaging Het
Tdrd6 C A 17: 43,629,819 A113S probably damaging Het
Tigd2 T G 6: 59,210,509 N120K probably damaging Het
Tomm70a A G 16: 57,136,734 N224S probably damaging Het
Tspo T C 15: 83,571,439 V9A probably benign Het
Vmn1r21 T A 6: 57,844,214 I82L probably benign Het
Vmn2r103 T A 17: 19,799,249 C532S probably damaging Het
Vmn2r76 T C 7: 86,230,063 N343S probably benign Het
Wdr62 T C 7: 30,252,360 K665E probably damaging Het
Xpc T A 6: 91,492,305 N820I probably damaging Het
Zfp418 A G 7: 7,181,874 T279A probably benign Het
Other mutations in Klk1b27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Klk1b27 APN 7 44056143 critical splice donor site probably null
IGL01328:Klk1b27 APN 7 44055879 missense probably damaging 1.00
IGL01552:Klk1b27 APN 7 44054615 missense probably damaging 1.00
IGL01632:Klk1b27 APN 7 44056673 utr 3 prime probably benign
R0574:Klk1b27 UTSW 7 44056101 missense probably damaging 1.00
R4723:Klk1b27 UTSW 7 44056532 missense probably damaging 1.00
R5800:Klk1b27 UTSW 7 44055664 missense probably benign 0.21
R6002:Klk1b27 UTSW 7 44055690 missense probably benign
R6244:Klk1b27 UTSW 7 44054550 missense probably benign 0.05
R6513:Klk1b27 UTSW 7 44055745 missense probably benign 0.00
R6584:Klk1b27 UTSW 7 44054511 missense possibly damaging 0.84
R6633:Klk1b27 UTSW 7 44055810 missense probably damaging 0.98
R7074:Klk1b27 UTSW 7 44056553 missense probably damaging 1.00
R7495:Klk1b27 UTSW 7 44056076 missense probably benign
R7830:Klk1b27 UTSW 7 44055726 missense probably benign 0.00
X0024:Klk1b27 UTSW 7 44056593 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CAAGCCTGCTGACATCACAG -3'
(R):5'- CCAGAACCACAGTTTTCTCAGC -3'

Sequencing Primer
(F):5'- TGCTGACATCACAGATGCTG -3'
(R):5'- CCCTTCACCTCATTGTAGAAAGGGG -3'
Posted On2020-01-23