Incidental Mutation 'R8002:Casp1'
ID 616414
Institutional Source Beutler Lab
Gene Symbol Casp1
Ensembl Gene ENSMUSG00000025888
Gene Name caspase 1
Synonyms ICE, Il1bc, Caspase-1, interleukin 1 beta-converting enzyme
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 5298517-5307265 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 5303164 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 206 (T206K)
Ref Sequence ENSEMBL: ENSMUSP00000027015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027015]
AlphaFold P29452
Predicted Effect possibly damaging
Transcript: ENSMUST00000027015
AA Change: T206K

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027015
Gene: ENSMUSG00000025888
AA Change: T206K

DomainStartEndE-ValueType
CARD 4 89 4.91e-19 SMART
CASc 151 400 1.82e-136 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous targeted mutants fail to produce mature IL1A and IL1B and are resistant to LPS-induced endotoxin shock and to FAS antibody-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 C T 7: 119,573,257 R133C possibly damaging Het
Adgrf4 T C 17: 42,667,792 E220G probably benign Het
Alx3 T A 3: 107,600,739 L188* probably null Het
Arhgef2 A T 3: 88,646,810 I969F probably damaging Het
Atf6 A G 1: 170,819,254 V350A probably benign Het
Atp1a3 C A 7: 25,000,671 G88V probably damaging Het
Brd8 T C 18: 34,608,556 T360A probably benign Het
Ccdc150 A G 1: 54,272,497 E214G probably damaging Het
Ccdc81 T C 7: 89,876,135 E477G probably benign Het
Celsr2 G T 3: 108,403,969 R1409S probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Cpne3 A T 4: 19,528,232 F342I probably damaging Het
Crot A C 5: 8,993,599 S8A probably benign Het
Cyp11b2 T C 15: 74,856,032 H67R probably damaging Het
Dnah1 A T 14: 31,298,722 L1230H probably damaging Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Gabrg3 T C 7: 56,734,968 T282A possibly damaging Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gm13199 A G 2: 5,862,647 S13P unknown Het
Gnptab A T 10: 88,440,268 D1139V probably benign Het
Jtb T C 3: 90,233,944 S76P probably benign Het
Klk1b27 T A 7: 44,056,021 D172E probably benign Het
Lpcat4 G A 2: 112,244,354 V307I probably benign Het
Ltn1 A C 16: 87,415,947 S575R probably benign Het
Map3k13 A G 16: 21,905,128 T287A probably benign Het
Marco T G 1: 120,494,780 I58L probably benign Het
Nadk G T 4: 155,577,198 probably null Het
Olfr746 A T 14: 50,653,857 I207F probably damaging Het
Otof G A 5: 30,380,610 T1215I probably benign Het
Pigw A T 11: 84,878,423 C27S probably benign Het
Pla2g10 A T 16: 13,725,048 M125K unknown Het
Rfx4 A C 10: 84,840,857 M204L probably damaging Het
Sept1 T C 7: 127,215,902 D209G probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc26a4 T C 12: 31,547,970 D159G probably benign Het
Sptbn4 C A 7: 27,417,992 S444I possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stard6 T A 18: 70,500,526 D201E possibly damaging Het
Tas2r114 T C 6: 131,689,139 T309A probably damaging Het
Tdrd6 C A 17: 43,629,819 A113S probably damaging Het
Tigd2 T G 6: 59,210,509 N120K probably damaging Het
Tomm70a A G 16: 57,136,734 N224S probably damaging Het
Tspo T C 15: 83,571,439 V9A probably benign Het
Vmn1r21 T A 6: 57,844,214 I82L probably benign Het
Vmn2r103 T A 17: 19,799,249 C532S probably damaging Het
Vmn2r76 T C 7: 86,230,063 N343S probably benign Het
Wdr62 T C 7: 30,252,360 K665E probably damaging Het
Xpc T A 6: 91,492,305 N820I probably damaging Het
Zfp418 A G 7: 7,181,874 T279A probably benign Het
Other mutations in Casp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Casp1 APN 9 5299872 splice site probably benign
IGL00667:Casp1 APN 9 5303756 missense probably benign 0.40
IGL01998:Casp1 APN 9 5303043 missense probably damaging 1.00
IGL02248:Casp1 APN 9 5299452 missense probably benign 0.01
IGL02469:Casp1 APN 9 5303105 missense probably benign 0.19
P0027:Casp1 UTSW 9 5299851 missense probably benign 0.00
PIT4305001:Casp1 UTSW 9 5306135 missense probably benign 0.03
R0724:Casp1 UTSW 9 5303077 missense probably benign
R1169:Casp1 UTSW 9 5299454 missense possibly damaging 0.93
R1876:Casp1 UTSW 9 5303663 missense probably benign 0.01
R2316:Casp1 UTSW 9 5306213 missense possibly damaging 0.92
R2877:Casp1 UTSW 9 5303110 missense probably damaging 1.00
R2885:Casp1 UTSW 9 5299851 missense probably benign 0.00
R4043:Casp1 UTSW 9 5302444 missense probably benign
R4367:Casp1 UTSW 9 5299333 missense probably benign 0.41
R4656:Casp1 UTSW 9 5304324 missense probably damaging 1.00
R4705:Casp1 UTSW 9 5306204 missense probably damaging 1.00
R4790:Casp1 UTSW 9 5303020 missense probably benign 0.01
R4858:Casp1 UTSW 9 5306742 missense probably damaging 1.00
R5607:Casp1 UTSW 9 5303143 missense probably damaging 1.00
R5784:Casp1 UTSW 9 5299337 missense probably damaging 0.98
R6578:Casp1 UTSW 9 5304280 missense probably benign 0.04
R7111:Casp1 UTSW 9 5299816 missense probably benign 0.01
R7215:Casp1 UTSW 9 5298523 splice site probably null
R7590:Casp1 UTSW 9 5306710 missense probably damaging 1.00
R8510:Casp1 UTSW 9 5303026 missense probably damaging 1.00
R8902:Casp1 UTSW 9 5299333 missense probably benign 0.41
R9234:Casp1 UTSW 9 5303128 missense probably benign 0.04
T0722:Casp1 UTSW 9 5299851 missense probably benign 0.00
X0003:Casp1 UTSW 9 5299851 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTTGGTTTCTTGAAAGGACTAAG -3'
(R):5'- CAATTGGATGTTACATGGCTAAACC -3'

Sequencing Primer
(F):5'- AGCAAGGCTGTTCATTCAATC -3'
(R):5'- CCATGTTTGAATTTGACAGCCATG -3'
Posted On 2020-01-23