Incidental Mutation 'R8002:Vmn2r103'
ID 616428
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Name vomeronasal 2, receptor 103
Synonyms EG627636
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R8002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 19773363-19812536 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19799249 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 532 (C532S)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
AlphaFold E9PWW0
Predicted Effect probably damaging
Transcript: ENSMUST00000172203
AA Change: C532S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: C532S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 C T 7: 119,573,257 R133C possibly damaging Het
Adgrf4 T C 17: 42,667,792 E220G probably benign Het
Alx3 T A 3: 107,600,739 L188* probably null Het
Arhgef2 A T 3: 88,646,810 I969F probably damaging Het
Atf6 A G 1: 170,819,254 V350A probably benign Het
Atp1a3 C A 7: 25,000,671 G88V probably damaging Het
Brd8 T C 18: 34,608,556 T360A probably benign Het
Casp1 C A 9: 5,303,164 T206K possibly damaging Het
Ccdc150 A G 1: 54,272,497 E214G probably damaging Het
Ccdc81 T C 7: 89,876,135 E477G probably benign Het
Celsr2 G T 3: 108,403,969 R1409S probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Cpne3 A T 4: 19,528,232 F342I probably damaging Het
Crot A C 5: 8,993,599 S8A probably benign Het
Cyp11b2 T C 15: 74,856,032 H67R probably damaging Het
Dnah1 A T 14: 31,298,722 L1230H probably damaging Het
Dqx1 G A 6: 83,058,577 D24N probably damaging Het
Gabrg3 T C 7: 56,734,968 T282A possibly damaging Het
Gm10093 T C 17: 78,492,287 S236P probably damaging Het
Gm13199 A G 2: 5,862,647 S13P unknown Het
Gnptab A T 10: 88,440,268 D1139V probably benign Het
Jtb T C 3: 90,233,944 S76P probably benign Het
Klk1b27 T A 7: 44,056,021 D172E probably benign Het
Lpcat4 G A 2: 112,244,354 V307I probably benign Het
Ltn1 A C 16: 87,415,947 S575R probably benign Het
Map3k13 A G 16: 21,905,128 T287A probably benign Het
Marco T G 1: 120,494,780 I58L probably benign Het
Nadk G T 4: 155,577,198 probably null Het
Olfr746 A T 14: 50,653,857 I207F probably damaging Het
Otof G A 5: 30,380,610 T1215I probably benign Het
Pigw A T 11: 84,878,423 C27S probably benign Het
Pla2g10 A T 16: 13,725,048 M125K unknown Het
Rfx4 A C 10: 84,840,857 M204L probably damaging Het
Sept1 T C 7: 127,215,902 D209G probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc26a4 T C 12: 31,547,970 D159G probably benign Het
Sptbn4 C A 7: 27,417,992 S444I possibly damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stard6 T A 18: 70,500,526 D201E possibly damaging Het
Tas2r114 T C 6: 131,689,139 T309A probably damaging Het
Tdrd6 C A 17: 43,629,819 A113S probably damaging Het
Tigd2 T G 6: 59,210,509 N120K probably damaging Het
Tomm70a A G 16: 57,136,734 N224S probably damaging Het
Tspo T C 15: 83,571,439 V9A probably benign Het
Vmn1r21 T A 6: 57,844,214 I82L probably benign Het
Vmn2r76 T C 7: 86,230,063 N343S probably benign Het
Wdr62 T C 7: 30,252,360 K665E probably damaging Het
Xpc T A 6: 91,492,305 N820I probably damaging Het
Zfp418 A G 7: 7,181,874 T279A probably benign Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 19793102 missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 19794965 missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 19792997 missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 19792967 missense probably benign
IGL01404:Vmn2r103 APN 17 19812434 missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 19794068 missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 19799208 missense probably benign
IGL02251:Vmn2r103 APN 17 19793969 missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19773369 missense probably benign
IGL02555:Vmn2r103 APN 17 19811611 missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 19794127 missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 19793956 missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 19812248 missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19773520 missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 19811979 missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 19811641 missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 19792859 missense probably benign 0.06
R0375:Vmn2r103 UTSW 17 19793464 missense probably benign 0.12
R0755:Vmn2r103 UTSW 17 19773568 missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 19793927 missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 19794247 missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 19792968 missense probably benign
R1488:Vmn2r103 UTSW 17 19793660 missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19773400 missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 19794234 missense probably benign
R1928:Vmn2r103 UTSW 17 19811767 missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 19812300 missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 19793794 missense probably benign
R2219:Vmn2r103 UTSW 17 19793647 missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19773531 missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 19793600 missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 19812149 missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 19794233 missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 19811815 missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 19811769 missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 19812171 missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 19793642 missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 19792989 missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 19794939 missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 19812453 missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 19794216 nonsense probably null
R6114:Vmn2r103 UTSW 17 19812325 missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 19812144 missense probably benign
R6292:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 19794082 missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 19811904 missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 19811977 missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 19793477 missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 19812052 missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 19794214 missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 19793123 missense probably benign 0.25
R8031:Vmn2r103 UTSW 17 19793497 missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 19811796 missense probably damaging 1.00
R8186:Vmn2r103 UTSW 17 19811943 missense probably damaging 1.00
R8559:Vmn2r103 UTSW 17 19812384 missense probably benign 0.01
R9413:Vmn2r103 UTSW 17 19811896 missense possibly damaging 0.54
R9591:Vmn2r103 UTSW 17 19811659 missense possibly damaging 0.70
R9652:Vmn2r103 UTSW 17 19793765 missense probably benign 0.01
R9680:Vmn2r103 UTSW 17 19799263 nonsense probably null
R9743:Vmn2r103 UTSW 17 19812213 missense probably damaging 1.00
Z1088:Vmn2r103 UTSW 17 19795047 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGTCATTATCAATGGATCCTGGGAG -3'
(R):5'- TTTAAGAACCCAGATATCCCTCAA -3'

Sequencing Primer
(F):5'- GGGTGAATAACAATACTCCTGCCTTC -3'
(R):5'- GGATGTTTCTGGAGAATAACAACC -3'
Posted On 2020-01-23