Incidental Mutation 'R8003:Slc24a2'
List |< first << previous [record 41 of 52] next >> last >|
ID616443
Institutional Source Beutler Lab
Gene Symbol Slc24a2
Ensembl Gene ENSMUSG00000037996
Gene Namesolute carrier family 24 (sodium/potassium/calcium exchanger), member 2
Synonyms6330417K15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R8003 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location86983124-87230477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87176315 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 322 (D322E)
Ref Sequence ENSEMBL: ENSMUSP00000102776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044990] [ENSMUST00000107155] [ENSMUST00000107157] [ENSMUST00000107158]
Predicted Effect probably benign
Transcript: ENSMUST00000044990
SMART Domains Protein: ENSMUSP00000043937
Gene: ENSMUSG00000037996

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 149 281 3.7e-34 PFAM
low complexity region 445 457 N/A INTRINSIC
transmembrane domain 472 489 N/A INTRINSIC
Pfam:Na_Ca_ex 509 648 8.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107155
SMART Domains Protein: ENSMUSP00000102773
Gene: ENSMUSG00000037996

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 149 281 3.6e-34 PFAM
low complexity region 428 440 N/A INTRINSIC
transmembrane domain 455 472 N/A INTRINSIC
Pfam:Na_Ca_ex 492 631 8.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107157
SMART Domains Protein: ENSMUSP00000102775
Gene: ENSMUSG00000037996

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 139 283 7.2e-32 PFAM
transmembrane domain 476 493 N/A INTRINSIC
Pfam:Na_Ca_ex 503 654 4.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107158
AA Change: D322E

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102776
Gene: ENSMUSG00000037996
AA Change: D322E

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 139 283 8e-32 PFAM
transmembrane domain 521 538 N/A INTRINSIC
Pfam:Na_Ca_ex 548 699 4.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146815
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium/cation antiporter superfamily of transport proteins. The encoded protein belongs to the SLC24 branch of exchangers, which can mediate the extrusion of one Ca2+ ion and one K+ ion in exchange for four Na+ ions. This family member is a retinal cone/brain exchanger that can mediate a light-induced decrease in free Ca2+ concentration. This protein may also play a neuroprotective role during ischemic brain injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutation of this gene results in loss of long term potentiation and an increase in long term depression and deficits in motor learning and spatial working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Slc24a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Slc24a2 APN 4 87227796 missense probably benign 0.01
IGL02080:Slc24a2 APN 4 87227146 missense probably damaging 1.00
IGL03121:Slc24a2 APN 4 87226906 missense probably benign 0.00
PIT4403001:Slc24a2 UTSW 4 87032286 missense probably benign 0.45
R0024:Slc24a2 UTSW 4 87028240 unclassified probably benign
R0024:Slc24a2 UTSW 4 87028240 unclassified probably benign
R0372:Slc24a2 UTSW 4 87227292 missense probably damaging 1.00
R1034:Slc24a2 UTSW 4 87032275 missense probably damaging 0.99
R1577:Slc24a2 UTSW 4 86991411 missense probably damaging 1.00
R1776:Slc24a2 UTSW 4 87176289 missense probably benign 0.01
R1955:Slc24a2 UTSW 4 87073244 missense probably damaging 1.00
R2043:Slc24a2 UTSW 4 86996645 missense probably damaging 1.00
R2091:Slc24a2 UTSW 4 87011646 missense probably damaging 1.00
R2114:Slc24a2 UTSW 4 86991355 missense probably benign 0.07
R2921:Slc24a2 UTSW 4 86991354 missense possibly damaging 0.46
R2922:Slc24a2 UTSW 4 86991354 missense possibly damaging 0.46
R2924:Slc24a2 UTSW 4 87011724 missense probably benign 0.34
R3806:Slc24a2 UTSW 4 87227784 missense possibly damaging 0.92
R3933:Slc24a2 UTSW 4 87176185 missense probably benign
R4052:Slc24a2 UTSW 4 87227205 missense probably damaging 1.00
R4207:Slc24a2 UTSW 4 87227205 missense probably damaging 1.00
R4466:Slc24a2 UTSW 4 87227862 utr 5 prime probably benign
R4531:Slc24a2 UTSW 4 86991478 missense possibly damaging 0.91
R4561:Slc24a2 UTSW 4 87227397 missense probably damaging 1.00
R4808:Slc24a2 UTSW 4 87032238 missense probably benign 0.01
R4884:Slc24a2 UTSW 4 86991508 missense probably damaging 0.98
R4893:Slc24a2 UTSW 4 87226908 missense probably damaging 0.98
R4936:Slc24a2 UTSW 4 87227347 missense probably damaging 1.00
R5035:Slc24a2 UTSW 4 87011706 missense possibly damaging 0.48
R5171:Slc24a2 UTSW 4 86996634 missense probably benign 0.40
R5369:Slc24a2 UTSW 4 86991388 missense probably damaging 0.99
R5924:Slc24a2 UTSW 4 87011588 intron probably null
R6046:Slc24a2 UTSW 4 86996645 missense probably damaging 1.00
R6725:Slc24a2 UTSW 4 87226882 critical splice donor site probably null
R6756:Slc24a2 UTSW 4 87176292 missense probably benign
R7087:Slc24a2 UTSW 4 86991219 utr 3 prime probably null
R7804:Slc24a2 UTSW 4 86991537 missense probably damaging 1.00
R8058:Slc24a2 UTSW 4 86991513 missense probably damaging 1.00
X0003:Slc24a2 UTSW 4 86991447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAATGCCAACTTGAGGG -3'
(R):5'- GCCCTGTCTTCATAGAGGTC -3'

Sequencing Primer
(F):5'- GGATACCTCTTCCATACAGCTG -3'
(R):5'- CCTGTCTTCATAGAGGTCACAAAGG -3'
Posted On2020-01-23