Incidental Mutation 'R8003:Plch2'
List |< first << previous [record 35 of 52] next >> last >|
ID616448
Institutional Source Beutler Lab
Gene Symbol Plch2
Ensembl Gene ENSMUSG00000029055
Gene Namephospholipase C, eta 2
SynonymsPlcl4, A930027K05Rik, PLCeta2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8003 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location154983115-155056784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 155054523 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 19 (G19D)
Ref Sequence ENSEMBL: ENSMUSP00000118629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000131173] [ENSMUST00000186598]
Predicted Effect unknown
Transcript: ENSMUST00000131173
AA Change: G19D
SMART Domains Protein: ENSMUSP00000118629
Gene: ENSMUSG00000029055
AA Change: G19D

DomainStartEndE-ValueType
Blast:PH 31 111 6e-49 BLAST
SCOP:d1mai__ 34 111 4e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186598
AA Change: G19D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055
AA Change: G19D

DomainStartEndE-ValueType
C2 79 189 5.8e-18 SMART
low complexity region 328 341 N/A INTRINSIC
low complexity region 407 435 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Plch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Plch2 APN 4 155006642 missense probably damaging 1.00
IGL02024:Plch2 APN 4 155043138 intron probably benign
IGL02580:Plch2 APN 4 154984764 missense probably benign 0.03
IGL03370:Plch2 APN 4 154986914 missense probably benign 0.18
IGL03407:Plch2 APN 4 154989798 missense probably damaging 1.00
tolerant UTSW 4 154984635 missense probably benign 0.01
PIT4418001:Plch2 UTSW 4 154989503 missense probably damaging 1.00
PIT4445001:Plch2 UTSW 4 155009026 missense probably damaging 1.00
R0117:Plch2 UTSW 4 154985358 unclassified probably benign
R0347:Plch2 UTSW 4 154986721 missense possibly damaging 0.91
R0361:Plch2 UTSW 4 155006711 missense possibly damaging 0.95
R0413:Plch2 UTSW 4 155006916 critical splice donor site probably null
R0487:Plch2 UTSW 4 155009012 missense probably damaging 1.00
R0514:Plch2 UTSW 4 154998886 missense probably damaging 1.00
R0734:Plch2 UTSW 4 154996283 missense probably damaging 1.00
R0766:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1306:Plch2 UTSW 4 155007140 missense probably damaging 1.00
R1312:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1602:Plch2 UTSW 4 154984450 missense probably damaging 0.99
R1717:Plch2 UTSW 4 154998272 missense probably benign
R1731:Plch2 UTSW 4 155006994 missense possibly damaging 0.83
R1769:Plch2 UTSW 4 155000083 missense probably damaging 1.00
R1875:Plch2 UTSW 4 154998508 missense probably damaging 1.00
R1974:Plch2 UTSW 4 154984953 missense possibly damaging 0.77
R2031:Plch2 UTSW 4 155043027 intron probably benign
R2050:Plch2 UTSW 4 155000818 missense probably benign 0.00
R2061:Plch2 UTSW 4 155042841 intron probably benign
R2073:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2075:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2109:Plch2 UTSW 4 154984597 missense possibly damaging 0.92
R2126:Plch2 UTSW 4 154998999 missense probably damaging 1.00
R2265:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2266:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2269:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2280:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2281:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2432:Plch2 UTSW 4 154986164 makesense probably null
R2971:Plch2 UTSW 4 154990767 missense probably benign 0.29
R3437:Plch2 UTSW 4 154991013 critical splice donor site probably null
R3980:Plch2 UTSW 4 154984798 missense probably benign 0.00
R4757:Plch2 UTSW 4 154996233 missense possibly damaging 0.88
R4827:Plch2 UTSW 4 154991113 missense probably damaging 1.00
R4828:Plch2 UTSW 4 154984635 missense probably benign 0.01
R4869:Plch2 UTSW 4 154989428 missense probably benign 0.28
R5020:Plch2 UTSW 4 155007083 missense probably damaging 1.00
R5050:Plch2 UTSW 4 155043309 intron probably benign
R5126:Plch2 UTSW 4 155000519 missense probably damaging 1.00
R5237:Plch2 UTSW 4 155010794 missense probably benign
R5274:Plch2 UTSW 4 154998954 missense probably damaging 1.00
R5296:Plch2 UTSW 4 154989999 intron probably null
R5324:Plch2 UTSW 4 154984534 missense probably benign
R5475:Plch2 UTSW 4 155000137 missense probably damaging 1.00
R5494:Plch2 UTSW 4 154991122 missense probably damaging 1.00
R5811:Plch2 UTSW 4 154992567 missense possibly damaging 0.62
R6083:Plch2 UTSW 4 155000818 missense probably benign 0.00
R6092:Plch2 UTSW 4 154984372 missense probably benign 0.02
R6253:Plch2 UTSW 4 155007101 missense probably damaging 1.00
R6456:Plch2 UTSW 4 154993002 missense probably damaging 1.00
R7038:Plch2 UTSW 4 154990032 intron probably null
R7084:Plch2 UTSW 4 154986991 missense probably benign 0.31
R7210:Plch2 UTSW 4 155009086 missense probably damaging 1.00
R7216:Plch2 UTSW 4 154984228 missense probably benign
R7264:Plch2 UTSW 4 154998967 missense probably damaging 0.98
R7291:Plch2 UTSW 4 154998472 missense probably damaging 1.00
R7423:Plch2 UTSW 4 154983737 missense probably damaging 1.00
R7436:Plch2 UTSW 4 154984096 missense probably benign 0.01
R7438:Plch2 UTSW 4 155000460 missense probably damaging 1.00
R7594:Plch2 UTSW 4 155007027 missense probably damaging 1.00
R7663:Plch2 UTSW 4 154991162 missense probably damaging 0.96
R7698:Plch2 UTSW 4 155002787 missense possibly damaging 0.95
R7844:Plch2 UTSW 4 154989465 missense probably damaging 1.00
R7927:Plch2 UTSW 4 154989465 missense probably damaging 1.00
R8007:Plch2 UTSW 4 155002831 missense probably damaging 1.00
RF014:Plch2 UTSW 4 155007120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAGCTGCCTTTGCACTGTG -3'
(R):5'- CATCTCAGCAAGGGACACTG -3'

Sequencing Primer
(F):5'- GGGCTCCCCAGATAAAGGG -3'
(R):5'- AAGGGACACTGGAGCCTCTG -3'
Posted On2020-01-23