Incidental Mutation 'R8003:Sbds'
ID616450
Institutional Source Beutler Lab
Gene Symbol Sbds
Ensembl Gene ENSMUSG00000025337
Gene NameSBDS ribosome maturation factor
SynonymsCGI-97, 4733401P19Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8003 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location130245731-130255530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 130250885 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 130 (V130F)
Ref Sequence ENSEMBL: ENSMUSP00000026387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026387] [ENSMUST00000044204] [ENSMUST00000125625] [ENSMUST00000139211]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026387
AA Change: V130F

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026387
Gene: ENSMUSG00000025337
AA Change: V130F

DomainStartEndE-ValueType
Pfam:SBDS 14 101 1.2e-36 PFAM
Pfam:SBDS_C 107 225 2.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044204
SMART Domains Protein: ENSMUSP00000047318
Gene: ENSMUSG00000056310

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.5e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125625
AA Change: V93F

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115494
Gene: ENSMUSG00000025337
AA Change: V93F

DomainStartEndE-ValueType
Pfam:SBDS 3 66 2.1e-25 PFAM
Pfam:SBDS_C 69 173 9.9e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139211
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is necessary for ribosome function and maintaining normal levels of protein synthesis. The encoded protein may function to activate ribosomes for translation, and may be involved in cellular response to stress and DNA damage. Loss of this gene is embryonic lethal while deficiency of the encoded protein in the pancreas is associated with symptoms of Shwachman-Diamond syndrome. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation and failure of gastrulation. Heterozygotes for the same allele are viable and fertile with no signs of Shwachman-Diamond syndrome related abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Sbds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Sbds APN 5 130254066 missense probably damaging 1.00
IGL02111:Sbds APN 5 130250941 missense probably damaging 1.00
R0421:Sbds UTSW 5 130253933 unclassified probably benign
R0546:Sbds UTSW 5 130254078 missense possibly damaging 0.93
R4693:Sbds UTSW 5 130250975 missense probably damaging 1.00
R5527:Sbds UTSW 5 130246406 missense possibly damaging 0.95
R6144:Sbds UTSW 5 130246344 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGAATGATGAGCACCAGCAC -3'
(R):5'- CCTACCTGTGCAGTAGAGAGATAC -3'

Sequencing Primer
(F):5'- TGAGCACCAGCACAGCCAG -3'
(R):5'- TACCCAGAACTGATGAGGGCTTTC -3'
Posted On2020-01-23