Incidental Mutation 'R8003:Ybx3'
ID616452
Institutional Source Beutler Lab
Gene Symbol Ybx3
Ensembl Gene ENSMUSG00000030189
Gene NameY box protein 3
SynonymsoxyR, MSY4, Yb2, Dpba, dbpA, MSY3, Csda
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8003 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location131364855-131388476 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 131368437 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 324 (Y324*)
Ref Sequence ENSEMBL: ENSMUSP00000032309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032309] [ENSMUST00000087865]
Predicted Effect probably null
Transcript: ENSMUST00000032309
AA Change: Y324*
SMART Domains Protein: ENSMUSP00000032309
Gene: ENSMUSG00000030189
AA Change: Y324*

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 14 71 N/A INTRINSIC
CSP 84 152 8.65e-24 SMART
low complexity region 166 182 N/A INTRINSIC
low complexity region 186 198 N/A INTRINSIC
low complexity region 212 232 N/A INTRINSIC
low complexity region 278 293 N/A INTRINSIC
low complexity region 315 329 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000087865
AA Change: Y255*
SMART Domains Protein: ENSMUSP00000085172
Gene: ENSMUSG00000030189
AA Change: Y255*

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 14 71 N/A INTRINSIC
CSP 84 152 8.65e-24 SMART
low complexity region 166 182 N/A INTRINSIC
low complexity region 209 224 N/A INTRINSIC
low complexity region 246 260 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Half of mice homozygous for a knock-out allele exhibit male infertility associated with smaller testes and reduced sperm production, partly due to increased spermatocyte apoptosis during mid to late spermatogenesis and progressive seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col5a1 G A 2: 27,958,328 probably benign Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Ybx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Ybx3 APN 6 131380929 missense probably damaging 1.00
IGL02203:Ybx3 APN 6 131368408 missense probably benign 0.01
PIT1430001:Ybx3 UTSW 6 131379459 missense probably damaging 1.00
R2869:Ybx3 UTSW 6 131370413 missense probably damaging 1.00
R2869:Ybx3 UTSW 6 131370413 missense probably damaging 1.00
R2870:Ybx3 UTSW 6 131370413 missense probably damaging 1.00
R2870:Ybx3 UTSW 6 131370413 missense probably damaging 1.00
R2873:Ybx3 UTSW 6 131370413 missense probably damaging 1.00
R4654:Ybx3 UTSW 6 131370327 missense probably damaging 0.99
R5878:Ybx3 UTSW 6 131367763 critical splice donor site probably null
R5881:Ybx3 UTSW 6 131368488 missense possibly damaging 0.71
R7796:Ybx3 UTSW 6 131368516 missense probably damaging 0.98
R7833:Ybx3 UTSW 6 131367863 missense possibly damaging 0.83
R7916:Ybx3 UTSW 6 131367863 missense possibly damaging 0.83
R8043:Ybx3 UTSW 6 131384506 missense probably benign 0.13
X0024:Ybx3 UTSW 6 131380904 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCCTAAGTAAGCAATGTTGTGC -3'
(R):5'- ATGCCCTTGAGTACTCCTGC -3'

Sequencing Primer
(F):5'- CTTGATTAAGTGTCCAGTTTCACACG -3'
(R):5'- GAGTACTCCTGCCCACCC -3'
Posted On2020-01-23