Incidental Mutation 'R8003:Dhx38'
List |< first << previous [record 13 of 52] next >> last >|
ID616459
Institutional Source Beutler Lab
Gene Symbol Dhx38
Ensembl Gene ENSMUSG00000037993
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 38
Synonyms5730550P09Rik, Ddx38, Prp16
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R8003 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location109548011-109565861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109556140 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 631 (D631E)
Ref Sequence ENSEMBL: ENSMUSP00000047865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042601]
Predicted Effect probably damaging
Transcript: ENSMUST00000042601
AA Change: D631E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047865
Gene: ENSMUSG00000037993
AA Change: D631E

DomainStartEndE-ValueType
Blast:DEXDc 3 146 2e-46 BLAST
low complexity region 147 204 N/A INTRINSIC
Blast:DEXDc 205 444 1e-105 BLAST
low complexity region 511 525 N/A INTRINSIC
DEXDc 531 715 6.88e-34 SMART
HELICc 759 862 1.11e-19 SMART
HA2 923 1013 3.22e-32 SMART
low complexity region 1163 1194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212667
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD/H box family of splicing factors. This protein resembles yeast Prp16 more closely than other DEAD/H family members. It is an ATPase and essential for the catalytic step II in pre-mRNA splicing process. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Dhx38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Dhx38 APN 8 109556934 missense possibly damaging 0.49
IGL00821:Dhx38 APN 8 109555654 missense probably benign 0.00
IGL00910:Dhx38 APN 8 109559034 missense probably benign 0.07
IGL01011:Dhx38 APN 8 109562691 missense probably benign
IGL01401:Dhx38 APN 8 109552114 missense probably benign 0.15
IGL02133:Dhx38 APN 8 109558241 nonsense probably null
IGL02529:Dhx38 APN 8 109559013 missense probably benign 0.00
IGL02652:Dhx38 APN 8 109556129 missense probably damaging 1.00
IGL03241:Dhx38 APN 8 109562656 missense possibly damaging 0.47
IGL03378:Dhx38 APN 8 109559090 splice site probably null
R0358:Dhx38 UTSW 8 109552462 missense probably benign 0.13
R0375:Dhx38 UTSW 8 109555181 missense possibly damaging 0.89
R0437:Dhx38 UTSW 8 109558629 splice site probably benign
R0481:Dhx38 UTSW 8 109556216 splice site probably benign
R0492:Dhx38 UTSW 8 109561944 splice site probably benign
R0528:Dhx38 UTSW 8 109562661 missense probably benign 0.00
R0607:Dhx38 UTSW 8 109558943 missense probably benign 0.07
R1638:Dhx38 UTSW 8 109553545 missense probably damaging 1.00
R2020:Dhx38 UTSW 8 109556869 splice site probably benign
R2056:Dhx38 UTSW 8 109562720 unclassified probably benign
R2096:Dhx38 UTSW 8 109554259 missense probably damaging 1.00
R2152:Dhx38 UTSW 8 109560674 missense probably benign 0.00
R2154:Dhx38 UTSW 8 109560674 missense probably benign 0.00
R2382:Dhx38 UTSW 8 109556140 missense probably damaging 0.99
R4367:Dhx38 UTSW 8 109553131 missense probably damaging 1.00
R4368:Dhx38 UTSW 8 109553131 missense probably damaging 1.00
R4369:Dhx38 UTSW 8 109553131 missense probably damaging 1.00
R5250:Dhx38 UTSW 8 109556520 missense probably damaging 1.00
R5354:Dhx38 UTSW 8 109555746 missense probably damaging 1.00
R5668:Dhx38 UTSW 8 109553416 missense probably damaging 1.00
R5777:Dhx38 UTSW 8 109556902 missense possibly damaging 0.81
R5784:Dhx38 UTSW 8 109559613 nonsense probably null
R6799:Dhx38 UTSW 8 109553202 missense probably damaging 1.00
R6915:Dhx38 UTSW 8 109559599 missense probably benign 0.15
R6932:Dhx38 UTSW 8 109552675 missense probably damaging 1.00
R7042:Dhx38 UTSW 8 109556985 missense possibly damaging 0.55
R7248:Dhx38 UTSW 8 109558927 missense probably benign 0.15
R7394:Dhx38 UTSW 8 109556523 missense probably damaging 1.00
R7513:Dhx38 UTSW 8 109560589 missense probably benign 0.00
R7569:Dhx38 UTSW 8 109560695 missense probably damaging 0.98
Z1177:Dhx38 UTSW 8 109556085 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACAGCTCAGCGTGAAGACAC -3'
(R):5'- TGCCATTTGTGCTGGAAGC -3'

Sequencing Primer
(F):5'- GGAAGCCTCACCCATCCTCTG -3'
(R):5'- CTGTGGTCTGCTTAAGCCTGAC -3'
Posted On2020-01-23