Incidental Mutation 'R8003:Mthfd1l'
List |< first << previous [record 26 of 52] next >> last >|
ID616461
Institutional Source Beutler Lab
Gene Symbol Mthfd1l
Ensembl Gene ENSMUSG00000040675
Gene Namemethylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
SynonymsFthfsdc1, 2410004L15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8003 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location3973118-4167081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 3984147 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 160 (S160A)
Ref Sequence ENSEMBL: ENSMUSP00000036178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043735] [ENSMUST00000117291] [ENSMUST00000120585]
Predicted Effect probably benign
Transcript: ENSMUST00000043735
AA Change: S160A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036178
Gene: ENSMUSG00000040675
AA Change: S160A

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:THF_DHG_CYH 71 179 2.9e-15 PFAM
Pfam:THF_DHG_CYH_C 182 337 1.1e-27 PFAM
Pfam:FTHFS 358 977 1.2e-260 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117291
AA Change: S160A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112870
Gene: ENSMUSG00000040675
AA Change: S160A

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:THF_DHG_CYH 71 179 2.9e-15 PFAM
Pfam:THF_DHG_CYH_C 182 337 1.1e-27 PFAM
Pfam:FTHFS 358 977 1.2e-260 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120585
AA Change: S160A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112897
Gene: ENSMUSG00000040675
AA Change: S160A

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:THF_DHG_CYH 70 179 8e-17 PFAM
Pfam:THF_DHG_CYH_C 182 337 5.4e-28 PFAM
Pfam:FTHFS 359 977 7.2e-260 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of tetrahydrofolate (THF) in the mitochondrion. THF is important in the de novo synthesis of purines and thymidylate and in the regeneration of methionine from homocysteine. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality, delayed embryonic growth, craniofacial anomalies, and neural tube defects including craniorachischisis, exencephaly and/or a wavy neural tube. Maternal formate supplementation reduces the incidence of NTDs and improves embryonic growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Mthfd1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Mthfd1l APN 10 3989971 synonymous probably benign
IGL01013:Mthfd1l APN 10 4030716 missense probably damaging 1.00
IGL01018:Mthfd1l APN 10 3978708 missense probably benign
IGL01018:Mthfd1l APN 10 4007800 missense probably benign
IGL01018:Mthfd1l APN 10 4032345 splice site probably benign
IGL01068:Mthfd1l APN 10 4028428 missense probably damaging 1.00
IGL01584:Mthfd1l APN 10 4016738 missense probably damaging 0.97
IGL01609:Mthfd1l APN 10 4018567 missense probably benign 0.00
IGL02272:Mthfd1l APN 10 4041812 missense probably damaging 0.99
IGL02344:Mthfd1l APN 10 4048272 splice site probably null
IGL02429:Mthfd1l APN 10 4089334 missense probably damaging 1.00
IGL02503:Mthfd1l APN 10 4083824 missense probably damaging 1.00
IGL02748:Mthfd1l APN 10 4018587 missense possibly damaging 0.94
IGL02748:Mthfd1l APN 10 3980268 critical splice donor site probably null
IGL03031:Mthfd1l APN 10 4018601 critical splice donor site probably null
IGL03047:Mthfd1l APN 10 3980409 splice site probably benign
IGL03215:Mthfd1l APN 10 4041826 missense probably benign 0.14
IGL03367:Mthfd1l APN 10 4106536 splice site probably benign
R0047:Mthfd1l UTSW 10 3978727 splice site probably benign
R0047:Mthfd1l UTSW 10 3978727 splice site probably benign
R0107:Mthfd1l UTSW 10 4041838 missense probably benign
R0348:Mthfd1l UTSW 10 4056766 missense probably damaging 1.00
R0496:Mthfd1l UTSW 10 4090006 missense probably benign
R0658:Mthfd1l UTSW 10 4047976 splice site probably null
R1177:Mthfd1l UTSW 10 3985661 missense possibly damaging 0.82
R1676:Mthfd1l UTSW 10 4083877 critical splice donor site probably null
R1703:Mthfd1l UTSW 10 4148093 missense probably damaging 1.00
R1888:Mthfd1l UTSW 10 4106528 missense probably damaging 1.00
R1888:Mthfd1l UTSW 10 4106528 missense probably damaging 1.00
R1891:Mthfd1l UTSW 10 4032284 nonsense probably null
R2014:Mthfd1l UTSW 10 4047894 missense probably benign
R2061:Mthfd1l UTSW 10 4103288 missense probably benign 0.00
R2197:Mthfd1l UTSW 10 4028399 missense probably damaging 1.00
R2360:Mthfd1l UTSW 10 4056771 missense probably damaging 1.00
R3085:Mthfd1l UTSW 10 4090007 missense probably benign 0.00
R3176:Mthfd1l UTSW 10 4148025 missense probably damaging 1.00
R3276:Mthfd1l UTSW 10 4148025 missense probably damaging 1.00
R4065:Mthfd1l UTSW 10 4032242 missense probably damaging 1.00
R4612:Mthfd1l UTSW 10 4030717 missense probably damaging 1.00
R4803:Mthfd1l UTSW 10 4007840 missense possibly damaging 0.52
R4883:Mthfd1l UTSW 10 4007775 missense probably benign 0.11
R4932:Mthfd1l UTSW 10 3980241 missense probably benign 0.00
R5507:Mthfd1l UTSW 10 4106432 missense probably benign 0.20
R5687:Mthfd1l UTSW 10 3990002 splice site probably null
R5694:Mthfd1l UTSW 10 4035239 missense possibly damaging 0.90
R5727:Mthfd1l UTSW 10 4103302 missense possibly damaging 0.86
R5908:Mthfd1l UTSW 10 4089392 missense probably damaging 1.00
R5951:Mthfd1l UTSW 10 4048222 missense probably damaging 1.00
R6330:Mthfd1l UTSW 10 3980234 missense probably benign
R6583:Mthfd1l UTSW 10 4047937 missense probably damaging 0.96
R6846:Mthfd1l UTSW 10 4047898 missense probably damaging 1.00
R7105:Mthfd1l UTSW 10 4103261 missense probably benign
R7456:Mthfd1l UTSW 10 4089998 missense probably damaging 1.00
R7848:Mthfd1l UTSW 10 4083739 missense possibly damaging 0.81
R7931:Mthfd1l UTSW 10 4083739 missense possibly damaging 0.81
R8073:Mthfd1l UTSW 10 3973417 missense probably benign 0.28
X0003:Mthfd1l UTSW 10 4089303 missense probably damaging 0.99
Z1088:Mthfd1l UTSW 10 4007844 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTGCACATCTGTATGCAG -3'
(R):5'- TCCAAGATACAGGACTTTCATTCACG -3'

Sequencing Primer
(F):5'- AACTCACTTTGCAGGCTAGG -3'
(R):5'- CGGAATTTTAAACATTCTCTACCTCC -3'
Posted On2020-01-23