Incidental Mutation 'R8003:Vmn2r80'
List |< first << previous [record 48 of 52] next >> last >|
ID616462
Institutional Source Beutler Lab
Gene Symbol Vmn2r80
Ensembl Gene ENSMUSG00000091888
Gene Namevomeronasal 2, receptor 80
SynonymsEG624765
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R8003 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location79148797-79195012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79148877 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 21 (I21T)
Ref Sequence ENSEMBL: ENSMUSP00000132299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165834]
Predicted Effect probably benign
Transcript: ENSMUST00000165834
AA Change: I21T

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132299
Gene: ENSMUSG00000091888
AA Change: I21T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 79 474 1.5e-36 PFAM
Pfam:NCD3G 517 570 7.9e-22 PFAM
Pfam:7tm_3 603 838 6.2e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Vmn2r80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Vmn2r80 APN 10 79194599 missense probably damaging 1.00
IGL01325:Vmn2r80 APN 10 79194247 missense possibly damaging 0.62
IGL01611:Vmn2r80 APN 10 79171654 missense probably damaging 1.00
IGL01799:Vmn2r80 APN 10 79171551 missense possibly damaging 0.95
IGL01877:Vmn2r80 APN 10 79171500 splice site probably null
IGL02673:Vmn2r80 APN 10 79169484 missense probably benign 0.02
IGL02756:Vmn2r80 APN 10 79194311 missense probably damaging 1.00
IGL02820:Vmn2r80 APN 10 79171605 missense probably benign 0.04
IGL03382:Vmn2r80 APN 10 79169528 missense probably damaging 1.00
R0071:Vmn2r80 UTSW 10 79171732 missense possibly damaging 0.83
R0071:Vmn2r80 UTSW 10 79171732 missense possibly damaging 0.83
R0129:Vmn2r80 UTSW 10 79169496 missense probably damaging 1.00
R0325:Vmn2r80 UTSW 10 79148939 missense possibly damaging 0.89
R0567:Vmn2r80 UTSW 10 79194831 missense possibly damaging 0.89
R1510:Vmn2r80 UTSW 10 79169719 missense possibly damaging 0.69
R1519:Vmn2r80 UTSW 10 79194219 missense probably damaging 1.00
R1520:Vmn2r80 UTSW 10 79194760 missense probably damaging 1.00
R1627:Vmn2r80 UTSW 10 79194415 missense probably damaging 1.00
R1709:Vmn2r80 UTSW 10 79194389 missense probably benign 0.04
R2116:Vmn2r80 UTSW 10 79194724 missense probably benign 0.09
R2237:Vmn2r80 UTSW 10 79168270 missense probably damaging 1.00
R2308:Vmn2r80 UTSW 10 79171621 missense probably damaging 1.00
R2893:Vmn2r80 UTSW 10 79148865 missense possibly damaging 0.63
R3408:Vmn2r80 UTSW 10 79168393 missense possibly damaging 0.95
R4502:Vmn2r80 UTSW 10 79148930 missense probably benign 0.00
R4685:Vmn2r80 UTSW 10 79194328 missense possibly damaging 0.95
R4851:Vmn2r80 UTSW 10 79194322 missense possibly damaging 0.68
R4947:Vmn2r80 UTSW 10 79194698 missense probably damaging 1.00
R5112:Vmn2r80 UTSW 10 79194458 missense possibly damaging 0.61
R5217:Vmn2r80 UTSW 10 79169146 missense possibly damaging 0.62
R5226:Vmn2r80 UTSW 10 79194040 missense probably benign 0.36
R5512:Vmn2r80 UTSW 10 79168232 missense probably benign 0.00
R5618:Vmn2r80 UTSW 10 79148921 missense probably benign
R5959:Vmn2r80 UTSW 10 79169479 missense probably benign 0.00
R6104:Vmn2r80 UTSW 10 79149020 missense probably benign 0.00
R6110:Vmn2r80 UTSW 10 79182003 missense probably damaging 1.00
R6270:Vmn2r80 UTSW 10 79194325 missense probably benign 0.00
R6508:Vmn2r80 UTSW 10 79194456 missense probably benign 0.03
R6843:Vmn2r80 UTSW 10 79169668 missense probably benign 0.08
R6894:Vmn2r80 UTSW 10 79169604 missense probably benign 0.06
R7048:Vmn2r80 UTSW 10 79194319 missense probably damaging 1.00
R7149:Vmn2r80 UTSW 10 79194820 missense probably benign 0.00
R7262:Vmn2r80 UTSW 10 79169745 missense probably damaging 0.98
R7559:Vmn2r80 UTSW 10 79194625 missense probably benign 0.00
R7622:Vmn2r80 UTSW 10 79194263 missense probably damaging 1.00
Z1176:Vmn2r80 UTSW 10 79169477 missense not run
Z1176:Vmn2r80 UTSW 10 79194398 missense possibly damaging 0.65
Z1176:Vmn2r80 UTSW 10 79194607 missense probably damaging 1.00
Z1176:Vmn2r80 UTSW 10 79194771 missense probably damaging 1.00
Z1177:Vmn2r80 UTSW 10 79169477 missense not run
Predicted Primers PCR Primer
(F):5'- AAAGGATCCCTGAAAACGTCTC -3'
(R):5'- ATATATGGAGCCTCGTGATGAG -3'

Sequencing Primer
(F):5'- GGATCCCTGAAAACGTCTCTAGATG -3'
(R):5'- CGTGATGAGAAATACTTGGGAAAATG -3'
Posted On2020-01-23