Incidental Mutation 'R8003:Cct4'
List |< first << previous [record 8 of 52] next >> last >|
ID616465
Institutional Source Beutler Lab
Gene Symbol Cct4
Ensembl Gene ENSMUSG00000007739
Gene Namechaperonin containing Tcp1, subunit 4 (delta)
Synonyms2610204B21Rik, A45, T complex protein 1, delta, Cctd, TCP-1 delta
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R8003 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location22990519-23003780 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 22996040 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020562] [ENSMUST00000173853] [ENSMUST00000173867] [ENSMUST00000174047] [ENSMUST00000174659]
Predicted Effect probably benign
Transcript: ENSMUST00000020562
SMART Domains Protein: ENSMUSP00000020562
Gene: ENSMUSG00000007739

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 61 509 1.6e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173853
SMART Domains Protein: ENSMUSP00000133677
Gene: ENSMUSG00000007739

DomainStartEndE-ValueType
PDB:4B2T|D 1 44 2e-11 PDB
Predicted Effect probably null
Transcript: ENSMUST00000173867
SMART Domains Protein: ENSMUSP00000133523
Gene: ENSMUSG00000007739

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 44 539 1.9e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174047
SMART Domains Protein: ENSMUSP00000134248
Gene: ENSMUSG00000007739

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 44 93 1.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174659
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The chaperonin containing TCP1 (MIM 186980) complex (CCT), also called the TCP1 ring complex, consists of 2 back-to-back rings, each containing 8 unique but homologous subunits, such as CCT4. CCT assists the folding of newly translated polypeptide substrates through multiple rounds of ATP-driven release and rebinding of partially folded intermediate forms. Substrates of CCT include the cytoskeletal proteins actin (see MIM 102560) and tubulin (see MIM 191130), as well as alpha-transducin (MIM 139330) (Won et al., 1998 [PubMed 9819444]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Cct4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Cct4 APN 11 22997656 missense possibly damaging 0.63
IGL02076:Cct4 APN 11 23002394 missense probably damaging 1.00
IGL02211:Cct4 APN 11 22993327 intron probably benign
IGL02416:Cct4 APN 11 23002868 missense probably damaging 1.00
R0030:Cct4 UTSW 11 23001357 unclassified probably benign
R0255:Cct4 UTSW 11 22999073 missense probably damaging 1.00
R0494:Cct4 UTSW 11 22996014 missense probably benign
R1244:Cct4 UTSW 11 22996417 missense probably benign 0.02
R1276:Cct4 UTSW 11 23002171 missense probably damaging 1.00
R1401:Cct4 UTSW 11 22994333 missense probably damaging 1.00
R1465:Cct4 UTSW 11 23002922 missense probably damaging 1.00
R1465:Cct4 UTSW 11 23002922 missense probably damaging 1.00
R1809:Cct4 UTSW 11 22997615 missense probably benign 0.00
R3907:Cct4 UTSW 11 23001560 missense probably benign 0.00
R4640:Cct4 UTSW 11 23002297 missense probably benign 0.04
R4785:Cct4 UTSW 11 23002866 missense probably damaging 1.00
R4836:Cct4 UTSW 11 23002898 missense probably benign 0.20
R5846:Cct4 UTSW 11 23001354 unclassified probably benign
R7193:Cct4 UTSW 11 22997111 missense probably benign 0.00
R7214:Cct4 UTSW 11 22990616 unclassified probably benign
R7336:Cct4 UTSW 11 23001564 missense possibly damaging 0.85
R7419:Cct4 UTSW 11 22996420 missense probably benign 0.01
R7725:Cct4 UTSW 11 22990814 missense probably benign
X0019:Cct4 UTSW 11 22997118 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TCATGCTCTGAGTTCGCTG -3'
(R):5'- ATGGTTGGATGTATACCTGCC -3'

Sequencing Primer
(F):5'- GTTAGGGTCTCATTTCTTAGCATC -3'
(R):5'- GGATGTATACCTGCCATTTATGAACC -3'
Posted On2020-01-23