Incidental Mutation 'R8003:Fbxw10'
List |< first << previous [record 16 of 52] next >> last >|
ID616466
Institutional Source Beutler Lab
Gene Symbol Fbxw10
Ensembl Gene ENSMUSG00000090173
Gene NameF-box and WD-40 domain protein 10
SynonymsSM2SH2, SM25H2, Fbw10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8003 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location62847069-62877465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 62857761 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 405 (C405G)
Ref Sequence ENSEMBL: ENSMUSP00000135870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036085] [ENSMUST00000150989] [ENSMUST00000176577] [ENSMUST00000177336]
Predicted Effect probably damaging
Transcript: ENSMUST00000036085
AA Change: C415G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046156
Gene: ENSMUSG00000090173
AA Change: C415G

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 6e-14 BLAST
Blast:WD40 416 453 2e-8 BLAST
WD40 457 496 1.78e-5 SMART
WD40 499 536 5.55e-7 SMART
WD40 539 575 2.84e-4 SMART
WD40 578 615 3.81e-5 SMART
WD40 620 656 6.9e-1 SMART
low complexity region 709 724 N/A INTRINSIC
coiled coil region 964 992 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150989
AA Change: C405G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117872
Gene: ENSMUSG00000090173
AA Change: C405G

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 1e-13 BLAST
Blast:WD40 406 443 2e-8 BLAST
WD40 447 486 1.78e-5 SMART
WD40 489 526 5.55e-7 SMART
WD40 529 565 2.84e-4 SMART
WD40 568 605 3.81e-5 SMART
WD40 610 646 6.9e-1 SMART
low complexity region 699 714 N/A INTRINSIC
coiled coil region 954 982 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176577
AA Change: C405G

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135870
Gene: ENSMUSG00000090173
AA Change: C405G

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 6e-14 BLAST
Blast:WD40 406 443 2e-8 BLAST
WD40 447 486 1.78e-5 SMART
WD40 489 526 5.55e-7 SMART
WD40 529 565 2.84e-4 SMART
WD40 568 605 3.81e-5 SMART
WD40 610 646 6.9e-1 SMART
low complexity region 704 719 N/A INTRINSIC
coiled coil region 959 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177336
AA Change: C405G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135294
Gene: ENSMUSG00000090173
AA Change: C405G

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
Blast:FBOX 286 326 5e-14 BLAST
Blast:WD40 406 443 1e-8 BLAST
WD40 447 486 1.78e-5 SMART
WD40 489 526 5.55e-7 SMART
WD40 529 565 2.84e-4 SMART
WD40 568 605 3.81e-5 SMART
WD40 610 646 6.9e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXW10, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Fbxw10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Fbxw10 APN 11 62873501 missense probably damaging 1.00
IGL01552:Fbxw10 APN 11 62857684 critical splice acceptor site probably null
IGL01625:Fbxw10 APN 11 62860027 missense probably damaging 1.00
IGL01960:Fbxw10 APN 11 62876756 missense probably damaging 1.00
IGL02457:Fbxw10 APN 11 62874982 missense probably damaging 1.00
IGL02475:Fbxw10 APN 11 62857735 missense possibly damaging 0.94
IGL02864:Fbxw10 APN 11 62873523 missense probably damaging 1.00
R0083:Fbxw10 UTSW 11 62877061 missense probably benign 0.00
R0108:Fbxw10 UTSW 11 62877061 missense probably benign 0.00
R0147:Fbxw10 UTSW 11 62847481 unclassified probably null
R0180:Fbxw10 UTSW 11 62853096 missense probably benign 0.09
R0196:Fbxw10 UTSW 11 62877244 missense probably benign 0.01
R0454:Fbxw10 UTSW 11 62876738 missense possibly damaging 0.53
R0529:Fbxw10 UTSW 11 62859845 missense probably damaging 1.00
R0791:Fbxw10 UTSW 11 62847456 missense probably benign 0.18
R0927:Fbxw10 UTSW 11 62876944 missense probably damaging 0.98
R1026:Fbxw10 UTSW 11 62875171 missense probably benign
R1448:Fbxw10 UTSW 11 62847592 missense possibly damaging 0.74
R1468:Fbxw10 UTSW 11 62862638 missense probably damaging 1.00
R1468:Fbxw10 UTSW 11 62862638 missense probably damaging 1.00
R1689:Fbxw10 UTSW 11 62860036 missense probably damaging 1.00
R1785:Fbxw10 UTSW 11 62859857 missense probably damaging 0.99
R2130:Fbxw10 UTSW 11 62859857 missense probably damaging 0.99
R2132:Fbxw10 UTSW 11 62859857 missense probably damaging 0.99
R2211:Fbxw10 UTSW 11 62867535 missense probably damaging 0.99
R3078:Fbxw10 UTSW 11 62867513 splice site probably benign
R3700:Fbxw10 UTSW 11 62869157 splice site probably null
R3932:Fbxw10 UTSW 11 62869157 splice site probably benign
R4843:Fbxw10 UTSW 11 62847325 missense possibly damaging 0.95
R4869:Fbxw10 UTSW 11 62862731 missense probably damaging 0.98
R4879:Fbxw10 UTSW 11 62847747 missense probably damaging 0.99
R4980:Fbxw10 UTSW 11 62847757 missense possibly damaging 0.94
R5417:Fbxw10 UTSW 11 62877164 missense possibly damaging 0.53
R5531:Fbxw10 UTSW 11 62862656 missense probably damaging 1.00
R5877:Fbxw10 UTSW 11 62857716 missense probably damaging 1.00
R6028:Fbxw10 UTSW 11 62873519 nonsense probably null
R6616:Fbxw10 UTSW 11 62853024 missense probably benign 0.14
R6870:Fbxw10 UTSW 11 62855367 missense probably damaging 0.99
R6967:Fbxw10 UTSW 11 62847603 missense possibly damaging 0.73
R7409:Fbxw10 UTSW 11 62876780 missense possibly damaging 0.86
R7464:Fbxw10 UTSW 11 62853298 missense probably benign 0.01
R7542:Fbxw10 UTSW 11 62850596 missense probably benign 0.33
R7568:Fbxw10 UTSW 11 62875168 missense probably benign
R7733:Fbxw10 UTSW 11 62873397 missense unknown
R7793:Fbxw10 UTSW 11 62847387 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAAACGTCAGCTTATGGGCC -3'
(R):5'- TTGCAGCAGAGAATGGCAC -3'

Sequencing Primer
(F):5'- CAGCAGCTACATCCTTGAAGGG -3'
(R):5'- AGGTGCACTACCTCTCAA -3'
Posted On2020-01-23