Incidental Mutation 'R8003:Zmynd15'
List |< first << previous [record 52 of 52]
ID616468
Institutional Source Beutler Lab
Gene Symbol Zmynd15
Ensembl Gene ENSMUSG00000040829
Gene Namezinc finger, MYND-type containing 15
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R8003 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location70459433-70466202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70460941 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 124 (H124Q)
Ref Sequence ENSEMBL: ENSMUSP00000048816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019064] [ENSMUST00000039093] [ENSMUST00000092958] [ENSMUST00000108563] [ENSMUST00000126105] [ENSMUST00000126391] [ENSMUST00000147289]
Predicted Effect probably benign
Transcript: ENSMUST00000019064
SMART Domains Protein: ENSMUSP00000019064
Gene: ENSMUSG00000018920

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:SCY 32 94 1e-17 BLAST
transmembrane domain 201 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039093
AA Change: H124Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048816
Gene: ENSMUSG00000040829
AA Change: H124Q

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 164 186 N/A INTRINSIC
Pfam:zf-MYND 307 353 6.7e-12 PFAM
low complexity region 438 452 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 702 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092958
AA Change: H124Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090635
Gene: ENSMUSG00000040829
AA Change: H124Q

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 164 186 N/A INTRINSIC
Pfam:zf-MYND 306 352 6.5e-11 PFAM
low complexity region 437 451 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
low complexity region 662 696 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108563
SMART Domains Protein: ENSMUSP00000104203
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
Pfam:zf-MYND 177 223 2.5e-11 PFAM
low complexity region 308 322 N/A INTRINSIC
low complexity region 393 405 N/A INTRINSIC
low complexity region 572 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126105
SMART Domains Protein: ENSMUSP00000134599
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126391
SMART Domains Protein: ENSMUSP00000133513
Gene: ENSMUSG00000018920

DomainStartEndE-ValueType
Blast:SCY 19 81 3e-18 BLAST
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147289
SMART Domains Protein: ENSMUSP00000136813
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a MYND-containing zinc-binding protein with a nuclear localization sequence. A similar gene in mice has been shown to act as a testis-specific transcriptional repressor by recruiting histone deacetylase enzymes to regulate spatiotemporal expression of many haploid genes. This protein may play an important role in spermatogenesis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele of Cxcl16 and Zmynd15 exhibit abnormal spermiogenesis and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Other mutations in Zmynd15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Zmynd15 APN 11 70465916 missense probably damaging 1.00
IGL01351:Zmynd15 APN 11 70463590 missense probably benign 0.28
R0086:Zmynd15 UTSW 11 70464232 missense probably damaging 1.00
R0196:Zmynd15 UTSW 11 70464226 missense probably damaging 1.00
R0667:Zmynd15 UTSW 11 70465118 missense probably damaging 1.00
R1511:Zmynd15 UTSW 11 70464793 missense probably damaging 0.98
R1660:Zmynd15 UTSW 11 70463502 missense probably damaging 1.00
R1750:Zmynd15 UTSW 11 70462567 missense probably benign 0.00
R4344:Zmynd15 UTSW 11 70461068 nonsense probably null
R4594:Zmynd15 UTSW 11 70464182 missense probably damaging 1.00
R4668:Zmynd15 UTSW 11 70462588 missense probably damaging 1.00
R5029:Zmynd15 UTSW 11 70462561 missense probably damaging 1.00
R5075:Zmynd15 UTSW 11 70462120 missense probably damaging 1.00
R5289:Zmynd15 UTSW 11 70466004 missense unknown
R5468:Zmynd15 UTSW 11 70461820 missense probably damaging 1.00
R6350:Zmynd15 UTSW 11 70464431 missense probably damaging 1.00
R6665:Zmynd15 UTSW 11 70464810 missense probably benign 0.01
R7078:Zmynd15 UTSW 11 70460755 missense probably damaging 1.00
R7426:Zmynd15 UTSW 11 70462188 missense probably benign 0.06
R7475:Zmynd15 UTSW 11 70461041 missense probably benign
R7673:Zmynd15 UTSW 11 70466040 missense unknown
Z1088:Zmynd15 UTSW 11 70461135 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TCTTACCAAACCGCAGTGTG -3'
(R):5'- TGACATGGTAGGACTCAGGGTG -3'

Sequencing Primer
(F):5'- AAACCGCAGTGTGGGCATC -3'
(R):5'- TAGGACTCAGGGTGGGGCC -3'
Posted On2020-01-23