Incidental Mutation 'R0676:Luzp1'
ID61647
Institutional Source Beutler Lab
Gene Symbol Luzp1
Ensembl Gene ENSMUSG00000001089
Gene Nameleucine zipper protein 1
SynonymsLuzp, 2700072H04Rik
MMRRC Submission 038861-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.898) question?
Stock #R0676 (G1)
Quality Score120
Status Validated
Chromosome4
Chromosomal Location136469761-136554780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136542685 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 740 (K740E)
Ref Sequence ENSEMBL: ENSMUSP00000130758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001116] [ENSMUST00000063021] [ENSMUST00000105849] [ENSMUST00000129230] [ENSMUST00000168936] [ENSMUST00000170102]
Predicted Effect probably damaging
Transcript: ENSMUST00000001116
AA Change: K740E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001116
Gene: ENSMUSG00000001089
AA Change: K740E

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000063021
AA Change: K740E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000060619
Gene: ENSMUSG00000001089
AA Change: K740E

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000105849
AA Change: K740E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101475
Gene: ENSMUSG00000001089
AA Change: K740E

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000129230
SMART Domains Protein: ENSMUSP00000128591
Gene: ENSMUSG00000001089

DomainStartEndE-ValueType
coiled coil region 11 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168936
Predicted Effect probably damaging
Transcript: ENSMUST00000170102
AA Change: K740E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130758
Gene: ENSMUSG00000001089
AA Change: K740E

DomainStartEndE-ValueType
SCOP:d1fxkc_ 96 233 4e-3 SMART
coiled coil region 264 350 N/A INTRINSIC
internal_repeat_1 569 638 9.92e-6 PROSPERO
low complexity region 756 769 N/A INTRINSIC
low complexity region 783 796 N/A INTRINSIC
internal_repeat_1 986 1056 9.92e-6 PROSPERO
Meta Mutation Damage Score 0.0693 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a leucine zipper motif. The exact function of the encoded protein is not known. In mice this gene affects neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
PHENOTYPE: Gene inactivation causes defective neural tube closure (exencephaly) and massive apoptosis in the hindbrain. Despite the incomplete penetrance of NTD, all homozygotes die perinatally due to complex cardiovascular anomalies. Other defects include an eyelid fusion defect, omphalocele and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,964,657 probably benign Het
Arhgef25 A G 10: 127,184,010 probably null Het
B3galnt2 T C 13: 13,995,793 S243P probably benign Het
Col11a2 A G 17: 34,057,275 N799D probably damaging Het
Cpb1 T C 3: 20,266,533 probably null Het
Crot A C 5: 8,993,622 probably benign Het
Ctnna3 A C 10: 64,409,261 H451P probably benign Het
Cts6 C T 13: 61,197,484 probably benign Het
Dock2 T C 11: 34,695,236 T540A probably damaging Het
Dysf C A 6: 84,113,336 F956L probably benign Het
Gabrg3 A T 7: 56,724,421 Y466N probably damaging Het
Gm10845 T A 14: 79,863,204 noncoding transcript Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
Hist1h4i T C 13: 22,041,106 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Immt A G 6: 71,851,844 S128G probably benign Het
Klb A T 5: 65,379,055 D576V probably damaging Het
Lpin1 A T 12: 16,540,979 N817K possibly damaging Het
Lrrk1 C T 7: 66,294,981 R627H probably damaging Het
Mapk9 T C 11: 49,883,156 *382Q probably null Het
Mn1 A G 5: 111,421,034 S957G possibly damaging Het
Mrgprb8 A T 7: 48,388,664 M28L probably benign Het
Myo1a A G 10: 127,719,880 I913V probably benign Het
Nolc1 T A 19: 46,080,089 probably benign Het
Pde4dip A C 3: 97,717,097 probably benign Het
Rbpj C T 5: 53,646,048 probably benign Het
Ric1 T C 19: 29,577,647 I387T probably benign Het
Ruvbl1 A G 6: 88,473,200 R58G probably damaging Het
Scarb1 C A 5: 125,297,214 probably benign Het
Sh3tc1 A T 5: 35,719,114 probably benign Het
Slc22a23 G A 13: 34,195,479 T435I probably damaging Het
Slc22a26 A T 19: 7,796,144 probably benign Het
Taf6l T C 19: 8,773,369 I114V probably benign Het
Tbc1d8b A G X: 139,712,276 S284G possibly damaging Het
Tmem131l C T 3: 83,934,815 probably benign Het
Vmn2r115 C T 17: 23,346,264 S375F probably benign Het
Other mutations in Luzp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Luzp1 APN 4 136542776 missense probably damaging 1.00
IGL01766:Luzp1 APN 4 136542773 missense possibly damaging 0.92
IGL01868:Luzp1 APN 4 136542737 missense probably damaging 1.00
IGL03230:Luzp1 APN 4 136542878 missense probably benign 0.02
FR4548:Luzp1 UTSW 4 136543188 small insertion probably benign
FR4737:Luzp1 UTSW 4 136543196 small insertion probably benign
R0106:Luzp1 UTSW 4 136542685 missense probably damaging 0.97
R0674:Luzp1 UTSW 4 136543457 missense possibly damaging 0.85
R1103:Luzp1 UTSW 4 136540730 missense possibly damaging 0.87
R1541:Luzp1 UTSW 4 136543325 missense probably damaging 1.00
R1812:Luzp1 UTSW 4 136542331 missense probably benign 0.03
R3924:Luzp1 UTSW 4 136542857 missense probably damaging 1.00
R4022:Luzp1 UTSW 4 136542193 missense probably benign 0.02
R4449:Luzp1 UTSW 4 136540863 missense probably damaging 1.00
R4976:Luzp1 UTSW 4 136543397 missense possibly damaging 0.69
R5119:Luzp1 UTSW 4 136543397 missense possibly damaging 0.69
R5411:Luzp1 UTSW 4 136543342 missense possibly damaging 0.59
R5659:Luzp1 UTSW 4 136542476 missense probably damaging 1.00
R5765:Luzp1 UTSW 4 136541029 missense probably damaging 0.98
R5828:Luzp1 UTSW 4 136540682 missense probably damaging 1.00
R6059:Luzp1 UTSW 4 136541480 missense probably benign 0.35
R6147:Luzp1 UTSW 4 136541063 missense probably damaging 1.00
R6181:Luzp1 UTSW 4 136543267 missense probably benign 0.01
R6200:Luzp1 UTSW 4 136541266 missense probably benign 0.12
R6368:Luzp1 UTSW 4 136541780 missense probably benign 0.24
R6581:Luzp1 UTSW 4 136540631 missense probably damaging 1.00
R6695:Luzp1 UTSW 4 136545298 missense possibly damaging 0.83
R6932:Luzp1 UTSW 4 136540813 nonsense probably null
R6998:Luzp1 UTSW 4 136543444 missense probably damaging 1.00
R7529:Luzp1 UTSW 4 136540932 missense probably damaging 1.00
R7878:Luzp1 UTSW 4 136541852 missense probably benign 0.00
R7961:Luzp1 UTSW 4 136541852 missense probably benign 0.00
RF028:Luzp1 UTSW 4 136543196 small insertion probably benign
RF033:Luzp1 UTSW 4 136543196 small insertion probably benign
RF040:Luzp1 UTSW 4 136543196 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGCCGTGTCATCAAATCCAG -3'
(R):5'- TCAGCTTCTGTGAGCTGCAAGG -3'

Sequencing Primer
(F):5'- GTTACTGCCAAGTTGGTGAACAC -3'
(R):5'- AGCTGACATGGTTGCTAATTGC -3'
Posted On2013-07-30