Incidental Mutation 'R8003:Rgs6'
ID616471
Institutional Source Beutler Lab
Gene Symbol Rgs6
Ensembl Gene ENSMUSG00000021219
Gene Nameregulator of G-protein signaling 6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R8003 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location82588292-83162056 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82985370 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 54 (S54P)
Ref Sequence ENSEMBL: ENSMUSP00000125256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101234] [ENSMUST00000161801] [ENSMUST00000185665] [ENSMUST00000185674] [ENSMUST00000186081] [ENSMUST00000186309] [ENSMUST00000186323] [ENSMUST00000186458] [ENSMUST00000186848] [ENSMUST00000191107] [ENSMUST00000191311] [ENSMUST00000191352] [ENSMUST00000200861] [ENSMUST00000200911] [ENSMUST00000201271] [ENSMUST00000201602] [ENSMUST00000201861] [ENSMUST00000202210]
Predicted Effect probably damaging
Transcript: ENSMUST00000101234
AA Change: S54P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098793
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161801
AA Change: S54P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125256
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185665
AA Change: S54P

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139566
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185674
AA Change: S54P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139940
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
RGS 299 414 7.5e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186081
AA Change: S54P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140188
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
RGS 299 414 7.5e-50 SMART
low complexity region 417 425 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186309
AA Change: S54P

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140701
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
low complexity region 494 499 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186323
AA Change: S54P

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141079
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
RGS 299 414 7.5e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186458
AA Change: S54P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139735
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186848
AA Change: S19P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141044
Gene: ENSMUSG00000021219
AA Change: S19P

DomainStartEndE-ValueType
DEP 5 80 1.6e-26 SMART
G_gamma 220 284 1.1e-27 SMART
GGL 223 284 8.8e-30 SMART
RGS 301 416 7.6e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191107
AA Change: S54P

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139725
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191311
AA Change: S54P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140723
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191352
AA Change: S54P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139718
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
DEP 40 115 1.5e-26 SMART
G_gamma 255 319 1e-27 SMART
GGL 258 319 8.7e-30 SMART
RGS 336 451 7.5e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200861
AA Change: S54P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144118
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
DEP 40 109 3.2e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200911
AA Change: S54P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143801
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201271
AA Change: S54P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144139
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
DEP 40 115 1.6e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201602
AA Change: S54P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144044
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
Pfam:DEP 43 73 1.1e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201861
AA Change: S54P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144395
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
Pfam:DEP 43 88 5.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202210
AA Change: S54P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143961
Gene: ENSMUSG00000021219
AA Change: S54P

DomainStartEndE-ValueType
DEP 40 115 3.28e-24 SMART
G_gamma 255 319 2.23e-23 SMART
GGL 258 319 1.38e-27 SMART
RGS 336 451 2.05e-47 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a member of the RGS (regulator of G protein signaling) family of proteins, which are defined by the presence of a RGS domain that confers the GTPase-activating activity of these proteins toward certain G alpha subunits. This protein also belongs to a subfamily of RGS proteins characterized by the presence of DEP (Dishevelled, Egl-10, and Pleckstrin) and GGL (G-protein gamma like)domains, the latter a G beta 5-interacting domain. The RGS proteins negatively regulate G protein signaling, and may modulate neuronal, cardiovascular, lymphocytic activities, and cancer risk. Mice lacking this gene exhibit decreased heart rate. Alternative splicing results in multiple transcript variants, however, the full-length nature of some of these variants is not known. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased heart rate and abnormal impulse conducting system conduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col5a1 G A 2: 27,958,328 probably benign Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Rgs6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Rgs6 APN 12 83051323 missense probably benign 0.01
IGL02131:Rgs6 APN 12 83069495 missense probably damaging 1.00
IGL02354:Rgs6 APN 12 82618619 intron probably benign
IGL02361:Rgs6 APN 12 82618619 intron probably benign
IGL02568:Rgs6 APN 12 83070602 missense probably benign 0.25
IGL02598:Rgs6 APN 12 83091797 missense probably benign 0.02
IGL03146:Rgs6 APN 12 83052538 missense probably damaging 1.00
IGL03248:Rgs6 APN 12 83052550 splice site probably benign
IGL03098:Rgs6 UTSW 12 82985376 missense probably damaging 1.00
IGL03147:Rgs6 UTSW 12 83091846 missense probably damaging 0.99
PIT4453001:Rgs6 UTSW 12 83091779 missense probably damaging 1.00
R0270:Rgs6 UTSW 12 83133689 missense probably damaging 1.00
R0390:Rgs6 UTSW 12 83133677 missense probably damaging 1.00
R0540:Rgs6 UTSW 12 83059804 nonsense probably null
R0630:Rgs6 UTSW 12 83047550 splice site probably benign
R1479:Rgs6 UTSW 12 83116244 missense probably damaging 1.00
R1533:Rgs6 UTSW 12 83091773 missense probably benign 0.00
R1545:Rgs6 UTSW 12 83116177 missense probably damaging 0.99
R2161:Rgs6 UTSW 12 83091804 missense probably damaging 1.00
R2421:Rgs6 UTSW 12 83116283 missense possibly damaging 0.93
R4089:Rgs6 UTSW 12 83063487 missense probably damaging 1.00
R4573:Rgs6 UTSW 12 83066015 missense probably damaging 1.00
R4821:Rgs6 UTSW 12 83067411 critical splice acceptor site probably null
R6228:Rgs6 UTSW 12 83065964 missense probably damaging 0.99
R7023:Rgs6 UTSW 12 83092104 intron probably benign
R7585:Rgs6 UTSW 12 83106870 missense probably damaging 1.00
R7610:Rgs6 UTSW 12 83091779 missense probably damaging 1.00
R7798:Rgs6 UTSW 12 83069519 missense probably benign 0.02
R8011:Rgs6 UTSW 12 83116292 missense probably null 0.32
R8081:Rgs6 UTSW 12 83047573 nonsense probably null
RF008:Rgs6 UTSW 12 83063449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACTGACTCGGGTTTTCC -3'
(R):5'- ACACACGCTTGAAAGGCTC -3'

Sequencing Primer
(F):5'- CCCTGATGCCTGTTATTAACAC -3'
(R):5'- GGCTTTTACTAAAAACCGAGACTGG -3'
Posted On2020-01-23