Incidental Mutation 'R8003:Ephx2'
List |< first << previous [record 15 of 52] next >> last >|
ID616476
Institutional Source Beutler Lab
Gene Symbol Ephx2
Ensembl Gene ENSMUSG00000022040
Gene Nameepoxide hydrolase 2, cytoplasmic
SynonymsEph2, sEP, sEH
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R8003 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location66084374-66124500 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 66124333 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070515] [ENSMUST00000070515]
PDB Structure
CRYSTAL STRUCTURE OF MURINE SOLUBLE EPOXIDE HYDROLASE. [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE SOLUBLE EPOXIDE HYDROLASE COMPLEXED WITH CPU INHIBITOR [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE SOLUBLE EPOXIDE HYDROLASE COMPLEXED WITH CIU INHIBITOR [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MURINE SOLUBLE EPOXIDE HYDROLASE COMPLEXED WITH CDU INHIBITOR [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000070515
SMART Domains Protein: ENSMUSP00000069209
Gene: ENSMUSG00000022040

DomainStartEndE-ValueType
Pfam:Hydrolase 3 197 1.2e-8 PFAM
Pfam:HAD_2 6 203 2.5e-17 PFAM
Pfam:Hydrolase_4 256 529 6.6e-11 PFAM
Pfam:Abhydrolase_1 257 530 7.2e-38 PFAM
Pfam:Abhydrolase_5 258 524 3.5e-14 PFAM
Pfam:Abhydrolase_6 259 536 2.7e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000070515
SMART Domains Protein: ENSMUSP00000069209
Gene: ENSMUSG00000022040

DomainStartEndE-ValueType
Pfam:Hydrolase 3 197 1.2e-8 PFAM
Pfam:HAD_2 6 203 2.5e-17 PFAM
Pfam:Hydrolase_4 256 529 6.6e-11 PFAM
Pfam:Abhydrolase_1 257 530 7.2e-38 PFAM
Pfam:Abhydrolase_5 258 524 3.5e-14 PFAM
Pfam:Abhydrolase_6 259 536 2.7e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epoxide hydrolase family. The protein, found in both the cytosol and peroxisomes, binds to specific epoxides and converts them to the corresponding dihydrodiols. Mutations in this gene have been associated with familial hypercholesterolemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Males homozygous for a targeted null mutation display a significant reduction in blood pressure both in the absence and presence of dietary salt loading. Both sexes exhibit altered arachidonic acid metabolism and reduced renal formation of epoxyeicosatrienoic and dihydroxyeicosatrienoic acids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col5a1 G A 2: 27,958,328 probably benign Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Ephx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ephx2 APN 14 66092837 missense probably benign
IGL01143:Ephx2 APN 14 66089522 missense probably damaging 1.00
IGL02058:Ephx2 APN 14 66103724 critical splice donor site probably null
IGL02164:Ephx2 APN 14 66103720 splice site probably benign
IGL02606:Ephx2 APN 14 66086292 missense probably damaging 1.00
PIT4618001:Ephx2 UTSW 14 66102222 missense probably damaging 0.99
R0396:Ephx2 UTSW 14 66108063 missense probably benign 0.03
R0732:Ephx2 UTSW 14 66086963 critical splice donor site probably null
R0762:Ephx2 UTSW 14 66102179 missense probably damaging 1.00
R1444:Ephx2 UTSW 14 66107320 missense probably damaging 1.00
R1689:Ephx2 UTSW 14 66087026 nonsense probably null
R1735:Ephx2 UTSW 14 66088303 missense probably benign
R1871:Ephx2 UTSW 14 66084734 missense probably damaging 1.00
R4210:Ephx2 UTSW 14 66084944 missense probably damaging 1.00
R5130:Ephx2 UTSW 14 66108062 missense probably damaging 0.97
R5800:Ephx2 UTSW 14 66107302 missense probably benign 0.38
R6013:Ephx2 UTSW 14 66110242 missense probably benign 0.19
R6076:Ephx2 UTSW 14 66092848 missense probably damaging 1.00
R6193:Ephx2 UTSW 14 66089512 missense probably benign 0.01
R6193:Ephx2 UTSW 14 66112220 missense probably benign 0.12
R7324:Ephx2 UTSW 14 66085354 missense probably damaging 1.00
R7390:Ephx2 UTSW 14 66110455
R7504:Ephx2 UTSW 14 66101617 missense probably damaging 0.99
R7759:Ephx2 UTSW 14 66089519 missense possibly damaging 0.67
R7814:Ephx2 UTSW 14 66110229 missense probably benign 0.09
R7863:Ephx2 UTSW 14 66107243 nonsense probably null
R7946:Ephx2 UTSW 14 66107243 nonsense probably null
R8157:Ephx2 UTSW 14 66108057 missense probably damaging 1.00
RF023:Ephx2 UTSW 14 66084929 critical splice donor site probably null
Z1088:Ephx2 UTSW 14 66107318 missense probably benign 0.00
Z1177:Ephx2 UTSW 14 66085325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCCTCTTTTCATGAAGGAG -3'
(R):5'- TAATCTTAGGTTCCCACAGCCAG -3'

Sequencing Primer
(F):5'- TTTGATCTTGCCCAGGCT -3'
(R):5'- CAGCCTCCCCACTCTAGG -3'
Posted On2020-01-23