Incidental Mutation 'R8003:Slc7a4'
ID616478
Institutional Source Beutler Lab
Gene Symbol Slc7a4
Ensembl Gene ENSMUSG00000022756
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 4
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R8003 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location17572018-17583214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 17574451 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 373 (V373G)
Ref Sequence ENSEMBL: ENSMUSP00000067243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023441] [ENSMUST00000063544] [ENSMUST00000171002] [ENSMUST00000172164] [ENSMUST00000231283] [ENSMUST00000231552] [ENSMUST00000231615] [ENSMUST00000231645] [ENSMUST00000231806] [ENSMUST00000232186] [ENSMUST00000232226] [ENSMUST00000232336] [ENSMUST00000232385]
Predicted Effect probably benign
Transcript: ENSMUST00000023441
SMART Domains Protein: ENSMUSP00000023441
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 385 7.9e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000063544
AA Change: V373G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067243
Gene: ENSMUSG00000022756
AA Change: V373G

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 436 1.4e-49 PFAM
Pfam:AA_permease 41 426 9.4e-38 PFAM
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 508 530 N/A INTRINSIC
Pfam:AA_permease_C 540 590 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171002
SMART Domains Protein: ENSMUSP00000132727
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 197 1e-65 PFAM
Pfam:P2X_receptor 185 362 7e-63 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172164
AA Change: V373G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127280
Gene: ENSMUSG00000022756
AA Change: V373G

DomainStartEndE-ValueType
Pfam:AA_permease_2 37 498 2.6e-46 PFAM
Pfam:AA_permease 41 423 4.5e-36 PFAM
transmembrane domain 508 530 N/A INTRINSIC
Pfam:AA_permease_C 540 590 1.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231283
Predicted Effect probably benign
Transcript: ENSMUST00000231552
Predicted Effect unknown
Transcript: ENSMUST00000231615
AA Change: V168G
Predicted Effect probably benign
Transcript: ENSMUST00000231645
Predicted Effect probably benign
Transcript: ENSMUST00000231806
Predicted Effect probably benign
Transcript: ENSMUST00000232186
Predicted Effect probably benign
Transcript: ENSMUST00000232226
Predicted Effect probably benign
Transcript: ENSMUST00000232336
Predicted Effect unknown
Transcript: ENSMUST00000232385
AA Change: V168G
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col5a1 G A 2: 27,958,328 probably benign Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Slc7a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02717:Slc7a4 APN 16 17574575 missense possibly damaging 0.90
R0066:Slc7a4 UTSW 16 17574011 missense probably benign 0.02
R0066:Slc7a4 UTSW 16 17574011 missense probably benign 0.02
R0402:Slc7a4 UTSW 16 17575633 missense probably damaging 1.00
R1426:Slc7a4 UTSW 16 17573944 critical splice donor site probably null
R1926:Slc7a4 UTSW 16 17575704 missense probably damaging 1.00
R2097:Slc7a4 UTSW 16 17573455 splice site probably null
R2140:Slc7a4 UTSW 16 17574544 missense possibly damaging 0.91
R4496:Slc7a4 UTSW 16 17575812 missense probably damaging 1.00
R4548:Slc7a4 UTSW 16 17575345 missense probably benign 0.01
R4570:Slc7a4 UTSW 16 17574277 missense probably benign 0.00
R4631:Slc7a4 UTSW 16 17574391 missense probably damaging 1.00
R4658:Slc7a4 UTSW 16 17575933 missense probably damaging 1.00
R4825:Slc7a4 UTSW 16 17574521 missense probably damaging 1.00
R5102:Slc7a4 UTSW 16 17575618 missense probably damaging 1.00
R5364:Slc7a4 UTSW 16 17573363 missense probably benign 0.33
R5650:Slc7a4 UTSW 16 17575684 missense possibly damaging 0.94
R5666:Slc7a4 UTSW 16 17575951 utr 5 prime probably benign
R5944:Slc7a4 UTSW 16 17574356 missense possibly damaging 0.95
R6769:Slc7a4 UTSW 16 17575320 missense possibly damaging 0.72
R7381:Slc7a4 UTSW 16 17575056 missense probably damaging 0.99
R7470:Slc7a4 UTSW 16 17575113 missense probably benign 0.07
R7903:Slc7a4 UTSW 16 17575281 missense probably benign 0.00
R7986:Slc7a4 UTSW 16 17575281 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCACTAGCTGTATATGGTCCG -3'
(R):5'- TCTGAGCTTATCTGCTGTGC -3'

Sequencing Primer
(F):5'- CCACTAGCTGTATATGGTCCGAAAAG -3'
(R):5'- ATCTGCTGTGCTGACTGC -3'
Posted On2020-01-23