Incidental Mutation 'R0676:2310003L06Rik'
ID61648
Institutional Source Beutler Lab
Gene Symbol 2310003L06Rik
Ensembl Gene ENSMUSG00000007457
Gene NameRIKEN cDNA 2310003L06 gene
Synonyms
MMRRC Submission 038861-MU
Accession Numbers

Genbank: AK009122; MGI: 1921498

Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R0676 (G1)
Quality Score123
Status Validated
Chromosome5
Chromosomal Location87969459-87972870 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 87964657 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007601] [ENSMUST00000187738]
Predicted Effect probably benign
Transcript: ENSMUST00000007601
SMART Domains Protein: ENSMUSP00000007601
Gene: ENSMUSG00000007457

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069773
SMART Domains Protein: ENSMUSP00000070337
Gene: ENSMUSG00000055961

DomainStartEndE-ValueType
coiled coil region 39 145 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 265 295 N/A INTRINSIC
low complexity region 307 335 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 405 424 N/A INTRINSIC
low complexity region 439 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199477
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef25 A G 10: 127,184,010 probably null Het
B3galnt2 T C 13: 13,995,793 S243P probably benign Het
Col11a2 A G 17: 34,057,275 N799D probably damaging Het
Cpb1 T C 3: 20,266,533 probably null Het
Crot A C 5: 8,993,622 probably benign Het
Ctnna3 A C 10: 64,409,261 H451P probably benign Het
Cts6 C T 13: 61,197,484 probably benign Het
Dock2 T C 11: 34,695,236 T540A probably damaging Het
Dysf C A 6: 84,113,336 F956L probably benign Het
Gabrg3 A T 7: 56,724,421 Y466N probably damaging Het
Gm10845 T A 14: 79,863,204 noncoding transcript Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
Hist1h4i T C 13: 22,041,106 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Immt A G 6: 71,851,844 S128G probably benign Het
Klb A T 5: 65,379,055 D576V probably damaging Het
Lpin1 A T 12: 16,540,979 N817K possibly damaging Het
Lrrk1 C T 7: 66,294,981 R627H probably damaging Het
Luzp1 A G 4: 136,542,685 K740E probably damaging Het
Mapk9 T C 11: 49,883,156 *382Q probably null Het
Mn1 A G 5: 111,421,034 S957G possibly damaging Het
Mrgprb8 A T 7: 48,388,664 M28L probably benign Het
Myo1a A G 10: 127,719,880 I913V probably benign Het
Nolc1 T A 19: 46,080,089 probably benign Het
Pde4dip A C 3: 97,717,097 probably benign Het
Rbpj C T 5: 53,646,048 probably benign Het
Ric1 T C 19: 29,577,647 I387T probably benign Het
Ruvbl1 A G 6: 88,473,200 R58G probably damaging Het
Scarb1 C A 5: 125,297,214 probably benign Het
Sh3tc1 A T 5: 35,719,114 probably benign Het
Slc22a23 G A 13: 34,195,479 T435I probably damaging Het
Slc22a26 A T 19: 7,796,144 probably benign Het
Taf6l T C 19: 8,773,369 I114V probably benign Het
Tbc1d8b A G X: 139,712,276 S284G possibly damaging Het
Tmem131l C T 3: 83,934,815 probably benign Het
Vmn2r115 C T 17: 23,346,264 S375F probably benign Het
Other mutations in 2310003L06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:2310003L06Rik APN 5 87972790 missense probably benign 0.37
IGL01938:2310003L06Rik APN 5 87971708 missense probably damaging 0.99
IGL03032:2310003L06Rik APN 5 87971915 missense possibly damaging 0.94
D3080:2310003L06Rik UTSW 5 87971987 missense possibly damaging 0.53
IGL02984:2310003L06Rik UTSW 5 87972803 missense probably damaging 0.97
PIT4243001:2310003L06Rik UTSW 5 87972140 missense possibly damaging 0.95
R0359:2310003L06Rik UTSW 5 87964596 unclassified probably benign
R1524:2310003L06Rik UTSW 5 87971689 missense probably benign 0.37
R1536:2310003L06Rik UTSW 5 87970665 missense probably benign
R1998:2310003L06Rik UTSW 5 87970694 missense probably damaging 0.98
R2080:2310003L06Rik UTSW 5 87971933 missense probably damaging 1.00
R2132:2310003L06Rik UTSW 5 87964476 unclassified probably benign
R2177:2310003L06Rik UTSW 5 87972453 missense probably damaging 0.98
R2399:2310003L06Rik UTSW 5 87972479 missense probably damaging 0.98
R3748:2310003L06Rik UTSW 5 87964563 unclassified probably benign
R4010:2310003L06Rik UTSW 5 87972277 missense probably damaging 0.96
R4096:2310003L06Rik UTSW 5 87972149 missense possibly damaging 0.57
R4656:2310003L06Rik UTSW 5 87964675 unclassified probably benign
R4823:2310003L06Rik UTSW 5 87972598 missense probably benign 0.00
R5753:2310003L06Rik UTSW 5 87972515 missense probably damaging 0.99
R6087:2310003L06Rik UTSW 5 87971762 missense possibly damaging 0.94
R6931:2310003L06Rik UTSW 5 87970702 missense probably damaging 0.97
R7032:2310003L06Rik UTSW 5 87972579 missense possibly damaging 0.79
R7703:2310003L06Rik UTSW 5 87972812 missense possibly damaging 0.90
R7912:2310003L06Rik UTSW 5 87972592 missense probably benign 0.35
R7993:2310003L06Rik UTSW 5 87972592 missense probably benign 0.35
Z1088:2310003L06Rik UTSW 5 87972306 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGACCACCACCCAAGCTATGGATG -3'
(R):5'- GCTACAGAAGTTGTGCCAGTTGTTG -3'

Sequencing Primer
(F):5'- ACCCAAGCTATGGATGGTTCTAC -3'
(R):5'- GACTTAGTGGTTCCTACAGGCAC -3'
Posted On2013-07-30