Incidental Mutation 'R8003:Eif2ak2'
List |< first << previous [record 14 of 52] next >> last >|
ID616480
Institutional Source Beutler Lab
Gene Symbol Eif2ak2
Ensembl Gene ENSMUSG00000024079
Gene Nameeukaryotic translation initiation factor 2-alpha kinase 2
SynonymsdsRNA-activated kinase, eIF-2 alpha, eIF-2 alpha, IFN- type I-induced and dsRNA-activated kinase, IFN-induced and double-stranded RNA-activated kinase, Pkr, Prkr, Tik
Accession Numbers

Genbank: NM_011163; MGI: 1353449

Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #R8003 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location78852564-78882573 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78876223 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 66 (A66S)
Ref Sequence ENSEMBL: ENSMUSP00000024884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024884]
PDB Structure
Solution structure of the second DSRM domain in Interferon-induced, double-stranded RNA-activated protein kinase [SOLUTION NMR]
Solution structure of the first DSRM domain in Interferon-induced, double-stranded RNA-activated protein kinase [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000024884
AA Change: A66S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024884
Gene: ENSMUSG00000024079
AA Change: A66S

DomainStartEndE-ValueType
DSRM 9 75 2.34e-20 SMART
DSRM 96 161 7.66e-16 SMART
low complexity region 169 196 N/A INTRINSIC
Pfam:Pkinase 242 500 4.6e-56 PFAM
Pfam:Pkinase_Tyr 242 500 8e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that is activated by autophosphorylation after binding to dsRNA. The activated form of the encoded protein can phosphorylate translation initiation factor EIF2S1, which in turn inhibits protein synthesis. This protein is also activated by manganese ions and heparin. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display altered susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI

 All alleles(7) : Targeted, knock-out(2) Gene trapped(5)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Eif2ak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Eif2ak2 APN 17 78869483 missense probably benign 0.00
IGL01017:Eif2ak2 APN 17 78863858 missense probably damaging 1.00
IGL01068:Eif2ak2 APN 17 78865371 missense probably damaging 1.00
3-1:Eif2ak2 UTSW 17 78869498 missense probably benign 0.00
R0038:Eif2ak2 UTSW 17 78863955 missense probably benign
R0801:Eif2ak2 UTSW 17 78866349 nonsense probably null
R1702:Eif2ak2 UTSW 17 78856634 missense probably damaging 1.00
R2020:Eif2ak2 UTSW 17 78863963 missense possibly damaging 0.87
R2159:Eif2ak2 UTSW 17 78874018 missense possibly damaging 0.77
R3405:Eif2ak2 UTSW 17 78858639 splice site probably benign
R3406:Eif2ak2 UTSW 17 78858639 splice site probably benign
R4355:Eif2ak2 UTSW 17 78858534 missense probably benign 0.08
R5135:Eif2ak2 UTSW 17 78866345 missense probably damaging 0.96
R5145:Eif2ak2 UTSW 17 78876204 missense possibly damaging 0.60
R5336:Eif2ak2 UTSW 17 78874043 missense probably benign 0.00
R6195:Eif2ak2 UTSW 17 78871233 nonsense probably null
R6233:Eif2ak2 UTSW 17 78871233 nonsense probably null
R6417:Eif2ak2 UTSW 17 78856619 missense probably damaging 1.00
R6737:Eif2ak2 UTSW 17 78863948 missense probably benign 0.00
R7108:Eif2ak2 UTSW 17 78858536 nonsense probably null
R7238:Eif2ak2 UTSW 17 78866331 missense probably benign 0.01
R7830:Eif2ak2 UTSW 17 78866403 missense probably damaging 1.00
R7843:Eif2ak2 UTSW 17 78868774 missense probably benign 0.24
R7845:Eif2ak2 UTSW 17 78863898 missense probably damaging 1.00
R7926:Eif2ak2 UTSW 17 78868774 missense probably benign 0.24
R7928:Eif2ak2 UTSW 17 78863898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAACAAGTCTCCTGGTG -3'
(R):5'- TTAAAGTCTGTCAGTGAGCCC -3'

Sequencing Primer
(F):5'- CCTGGTGTATTTCTCACTCAGAAG -3'
(R):5'- AGTGAGCCCGGGTTCGAATC -3'
Posted On2020-01-23