Incidental Mutation 'R8003:Ccdc178'
List |< first << previous [record 7 of 52] next >> last >|
ID616482
Institutional Source Beutler Lab
Gene Symbol Ccdc178
Ensembl Gene ENSMUSG00000024306
Gene Namecoiled coil domain containing 178
Synonyms4921528I01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8003 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location21810897-22171396 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 21844887 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025160] [ENSMUST00000115837]
Predicted Effect probably null
Transcript: ENSMUST00000025160
SMART Domains Protein: ENSMUSP00000025160
Gene: ENSMUSG00000024306

DomainStartEndE-ValueType
coiled coil region 157 204 N/A INTRINSIC
coiled coil region 226 266 N/A INTRINSIC
coiled coil region 292 404 N/A INTRINSIC
coiled coil region 514 541 N/A INTRINSIC
coiled coil region 570 631 N/A INTRINSIC
coiled coil region 665 705 N/A INTRINSIC
low complexity region 720 732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115837
SMART Domains Protein: ENSMUSP00000111503
Gene: ENSMUSG00000024306

DomainStartEndE-ValueType
coiled coil region 157 204 N/A INTRINSIC
coiled coil region 226 266 N/A INTRINSIC
coiled coil region 292 404 N/A INTRINSIC
coiled coil region 514 541 N/A INTRINSIC
coiled coil region 570 631 N/A INTRINSIC
coiled coil region 665 705 N/A INTRINSIC
low complexity region 720 732 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Ccdc178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Ccdc178 APN 18 21844911 missense probably benign 0.05
IGL00743:Ccdc178 APN 18 22145444 splice site probably benign
IGL00906:Ccdc178 APN 18 22135168 nonsense probably null
IGL01352:Ccdc178 APN 18 22018974 splice site probably benign
IGL01553:Ccdc178 APN 18 21915006 missense probably damaging 0.97
IGL01607:Ccdc178 APN 18 22067721 missense probably benign 0.01
IGL01733:Ccdc178 APN 18 22024812 splice site probably benign
IGL01795:Ccdc178 APN 18 22019118 missense probably benign 0.04
IGL01996:Ccdc178 APN 18 22097756 missense probably damaging 0.99
IGL02939:Ccdc178 APN 18 22120718 missense probably benign 0.01
IGL03213:Ccdc178 APN 18 22120691 missense possibly damaging 0.89
IGL03253:Ccdc178 APN 18 21845011 nonsense probably null
IGL03331:Ccdc178 APN 18 21811583 splice site probably null
PIT4520001:Ccdc178 UTSW 18 22067413 missense probably damaging 0.97
R0121:Ccdc178 UTSW 18 21845024 critical splice acceptor site probably null
R0153:Ccdc178 UTSW 18 22150435 missense probably benign 0.00
R0364:Ccdc178 UTSW 18 21915062 missense probably damaging 0.97
R0604:Ccdc178 UTSW 18 22067443 missense probably benign 0.01
R0709:Ccdc178 UTSW 18 22067662 missense probably damaging 0.97
R0961:Ccdc178 UTSW 18 22019041 missense possibly damaging 0.79
R1029:Ccdc178 UTSW 18 22097725 missense possibly damaging 0.89
R1456:Ccdc178 UTSW 18 22150424 missense possibly damaging 0.81
R1481:Ccdc178 UTSW 18 22105621 missense probably benign 0.00
R1596:Ccdc178 UTSW 18 22020873 missense possibly damaging 0.79
R1739:Ccdc178 UTSW 18 22097723 missense possibly damaging 0.92
R1838:Ccdc178 UTSW 18 22067638 missense probably damaging 0.97
R2214:Ccdc178 UTSW 18 21914990 missense possibly damaging 0.73
R2401:Ccdc178 UTSW 18 22131414 critical splice donor site probably null
R2679:Ccdc178 UTSW 18 21811556 missense possibly damaging 0.90
R3051:Ccdc178 UTSW 18 22135131 missense probably benign 0.05
R3150:Ccdc178 UTSW 18 22067652 missense possibly damaging 0.95
R3151:Ccdc178 UTSW 18 21811561 missense probably benign 0.00
R3177:Ccdc178 UTSW 18 22067652 missense possibly damaging 0.95
R3277:Ccdc178 UTSW 18 22067652 missense possibly damaging 0.95
R3903:Ccdc178 UTSW 18 22023095 missense possibly damaging 0.79
R4184:Ccdc178 UTSW 18 22024784 missense probably damaging 1.00
R4258:Ccdc178 UTSW 18 22017335 splice site probably null
R4319:Ccdc178 UTSW 18 22033543 nonsense probably null
R4321:Ccdc178 UTSW 18 22033543 nonsense probably null
R4323:Ccdc178 UTSW 18 22033543 nonsense probably null
R4509:Ccdc178 UTSW 18 22067392 missense possibly damaging 0.94
R4672:Ccdc178 UTSW 18 22150444 nonsense probably null
R5078:Ccdc178 UTSW 18 22067628 critical splice donor site probably null
R5099:Ccdc178 UTSW 18 22105591 missense probably benign
R5679:Ccdc178 UTSW 18 22067429 missense probably benign
R5683:Ccdc178 UTSW 18 22130122 missense probably benign 0.00
R6120:Ccdc178 UTSW 18 22097728 missense probably benign 0.00
R6318:Ccdc178 UTSW 18 22120534 missense possibly damaging 0.90
R6717:Ccdc178 UTSW 18 22020889 missense probably damaging 0.98
R6853:Ccdc178 UTSW 18 22109876 missense probably benign 0.00
R6980:Ccdc178 UTSW 18 22105563 missense probably benign
R7019:Ccdc178 UTSW 18 22150438 missense probably benign 0.00
R7246:Ccdc178 UTSW 18 22109754 missense possibly damaging 0.92
R7322:Ccdc178 UTSW 18 22105549 missense probably benign 0.15
R7340:Ccdc178 UTSW 18 22017461 missense probably benign 0.17
R7371:Ccdc178 UTSW 18 22130138 missense probably benign 0.01
X0063:Ccdc178 UTSW 18 21844912 missense probably benign 0.12
Z1177:Ccdc178 UTSW 18 22109731 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CCCAAAGTATGCATGGTGTG -3'
(R):5'- ATCATTCTTCTTGAACGGTGCC -3'

Sequencing Primer
(F):5'- CCAAAGTATGCATGGTGTGTGGTATG -3'
(R):5'- TGAACGGTGCCATTAATTTCC -3'
Posted On2020-01-23