Incidental Mutation 'R8003:Lars'
List |< first << previous [record 23 of 52] next >> last >|
ID616484
Institutional Source Beutler Lab
Gene Symbol Lars
Ensembl Gene ENSMUSG00000024493
Gene Nameleucyl-tRNA synthetase
Synonyms2310045K21Rik, 3110009L02Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8003 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location42202350-42262122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42221619 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 754 (D754E)
Ref Sequence ENSEMBL: ENSMUSP00000095197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097590]
Predicted Effect probably damaging
Transcript: ENSMUST00000097590
AA Change: D754E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095197
Gene: ENSMUSG00000024493
AA Change: D754E

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 19 112 5.8e-12 PFAM
Pfam:tRNA-synt_1g 48 114 3.5e-7 PFAM
low complexity region 141 157 N/A INTRINSIC
Pfam:tRNA-synt_1 173 758 3.6e-26 PFAM
Pfam:tRNA-synt_1g 632 764 1e-9 PFAM
Pfam:tRNA-synt_1e 660 761 2.8e-7 PFAM
Pfam:Anticodon_1 796 930 3e-18 PFAM
Blast:IL1 950 1086 4e-37 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic leucine-tRNA synthetase, a member of the class I aminoacyl-tRNA synthetase family. The encoded enzyme catalyzes the ATP-dependent ligation of L-leucine to tRNA(Leu). It is found in the cytoplasm as part of a multisynthetase complex and interacts with the arginine tRNA synthetase through its C-terminal domain. A mutation in this gene was found in affected individuals with infantile liver failure syndrome 1. Alternatively spliced transcript variants of this gene have been observed. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Lars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Lars APN 18 42229654 missense probably damaging 0.99
IGL01340:Lars APN 18 42202577 missense probably benign 0.01
IGL01397:Lars APN 18 42228029 missense probably damaging 1.00
IGL01510:Lars APN 18 42242109 missense probably benign
IGL01542:Lars APN 18 42214827 missense probably benign 0.09
IGL01689:Lars APN 18 42216949 missense probably benign
IGL01819:Lars APN 18 42202550 missense probably benign 0.00
IGL02142:Lars APN 18 42227280 missense probably benign 0.01
IGL02598:Lars APN 18 42227277 missense possibly damaging 0.61
IGL02630:Lars APN 18 42257169 missense probably damaging 0.97
IGL02973:Lars APN 18 42214759 critical splice donor site probably null
IGL03064:Lars APN 18 42221571 nonsense probably null
IGL03081:Lars APN 18 42210091 missense probably benign 0.00
IGL03330:Lars APN 18 42219944 missense probably benign
IGL03334:Lars APN 18 42221506 missense probably benign
IGL03340:Lars APN 18 42228650 splice site probably benign
R0165:Lars UTSW 18 42202697 missense possibly damaging 0.91
R0321:Lars UTSW 18 42202632 missense probably damaging 0.96
R0325:Lars UTSW 18 42250902 missense possibly damaging 0.88
R0391:Lars UTSW 18 42251363 missense probably benign 0.00
R0558:Lars UTSW 18 42214837 missense probably benign
R0624:Lars UTSW 18 42242784 splice site probably benign
R0881:Lars UTSW 18 42214786 missense probably benign 0.22
R0968:Lars UTSW 18 42218583 missense probably benign 0.09
R1457:Lars UTSW 18 42210050 missense probably damaging 1.00
R1466:Lars UTSW 18 42210050 missense probably damaging 1.00
R1466:Lars UTSW 18 42210050 missense probably damaging 1.00
R1583:Lars UTSW 18 42210050 missense probably damaging 1.00
R1584:Lars UTSW 18 42210050 missense probably damaging 1.00
R1851:Lars UTSW 18 42212608 missense probably benign 0.09
R1852:Lars UTSW 18 42212608 missense probably benign 0.09
R1868:Lars UTSW 18 42214837 missense probably benign 0.04
R1954:Lars UTSW 18 42210050 missense probably damaging 1.00
R2277:Lars UTSW 18 42235502 missense probably benign 0.00
R3732:Lars UTSW 18 42212602 missense probably benign 0.00
R3732:Lars UTSW 18 42212602 missense probably benign 0.00
R3733:Lars UTSW 18 42212602 missense probably benign 0.00
R4208:Lars UTSW 18 42229703 missense probably benign 0.34
R4571:Lars UTSW 18 42228230 splice site probably null
R5009:Lars UTSW 18 42221547 missense probably benign 0.03
R5033:Lars UTSW 18 42214776 missense possibly damaging 0.92
R5152:Lars UTSW 18 42228777 missense possibly damaging 0.96
R5208:Lars UTSW 18 42217557 missense probably benign
R5219:Lars UTSW 18 42234720 missense probably benign 0.44
R5396:Lars UTSW 18 42216959 missense probably benign
R5433:Lars UTSW 18 42251298 missense possibly damaging 0.66
R5580:Lars UTSW 18 42214851 missense probably damaging 0.98
R5610:Lars UTSW 18 42257091 missense probably benign
R5784:Lars UTSW 18 42219899 missense probably benign 0.00
R6249:Lars UTSW 18 42257206 splice site probably null
R6334:Lars UTSW 18 42217486 missense probably benign
R6618:Lars UTSW 18 42244908 missense possibly damaging 0.86
R6900:Lars UTSW 18 42234610 missense probably benign
R6958:Lars UTSW 18 42236639 missense probably damaging 1.00
R7390:Lars UTSW 18 42210018 critical splice donor site probably null
R7451:Lars UTSW 18 42202550 missense probably benign 0.00
R7618:Lars UTSW 18 42244891 missense probably benign 0.10
R7831:Lars UTSW 18 42217562 missense probably benign 0.24
R7914:Lars UTSW 18 42217562 missense probably benign 0.24
X0064:Lars UTSW 18 42228060 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAGACTTAGTGACTGCCATGGC -3'
(R):5'- TTGCATGTACCCAGTTAAATGC -3'

Sequencing Primer
(F):5'- ATGGCATAGCACTGGCCC -3'
(R):5'- ACTTTCTATGTAGCGAGGATGACC -3'
Posted On2020-01-23