Incidental Mutation 'R8003:Wnt8b'
ID616485
Institutional Source Beutler Lab
Gene Symbol Wnt8b
Ensembl Gene ENSMUSG00000036961
Gene Namewingless-type MMTV integration site family, member 8B
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8003 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location44493472-44514273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44511957 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 328 (C328S)
Ref Sequence ENSEMBL: ENSMUSP00000042867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041163] [ENSMUST00000063632]
Predicted Effect probably damaging
Transcript: ENSMUST00000041163
AA Change: C328S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042867
Gene: ENSMUSG00000036961
AA Change: C328S

DomainStartEndE-ValueType
WNT1 38 351 1.02e-185 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063632
SMART Domains Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984

DomainStartEndE-ValueType
Blast:WD40 56 101 5e-18 BLAST
WD40 110 150 4.76e-6 SMART
WD40 159 197 1.53e1 SMART
WD40 200 245 1.85e0 SMART
WD40 249 289 2.15e-4 SMART
WD40 292 332 6.19e-1 SMART
low complexity region 551 561 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 909 929 N/A INTRINSIC
low complexity region 1009 1018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 95%, 86% and 71% amino acid identity to the mouse, zebrafish and Xenopus Wnt8B proteins, respectively. The expression patterns of the human and mouse genes appear identical and are restricted to the developing brain. The chromosomal location of this gene to 10q24 suggests it as a candidate gene for partial epilepsy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and healthy with no evidence of hippocampal or hypothalamic defects and normal cell proliferation in the neurogenic region of the adult dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col5a1 G A 2: 27,958,328 probably benign Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Olfr1164 A T 2: 88,093,245 Y230* probably null Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Wnt8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Wnt8b APN 19 44511265 missense probably damaging 1.00
R0601:Wnt8b UTSW 19 44493667 missense probably benign 0.01
R0948:Wnt8b UTSW 19 44510529 missense possibly damaging 0.69
R1315:Wnt8b UTSW 19 44512023 missense probably damaging 1.00
R1672:Wnt8b UTSW 19 44511276 missense probably damaging 1.00
R1864:Wnt8b UTSW 19 44493590 missense probably benign 0.08
R5728:Wnt8b UTSW 19 44511318 missense possibly damaging 0.69
R6180:Wnt8b UTSW 19 44511643 missense probably benign 0.01
R6997:Wnt8b UTSW 19 44511841 missense probably damaging 1.00
R7187:Wnt8b UTSW 19 44511682 missense probably benign 0.04
R7216:Wnt8b UTSW 19 44512072 missense probably benign
R7469:Wnt8b UTSW 19 44511562 missense possibly damaging 0.83
R7673:Wnt8b UTSW 19 44511688 missense possibly damaging 0.73
R8055:Wnt8b UTSW 19 44493513 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GACTACTGCCTGGAGAACAAG -3'
(R):5'- AGAATCTCTGGGCTAGGGAGTG -3'

Sequencing Primer
(F):5'- TGCCTGGAGAACAAGACCCTG -3'
(R):5'- CTCTATTTCCGGGGGTCTCTAAAG -3'
Posted On2020-01-23