Incidental Mutation 'R8004:Slc35f5'
ID616488
Institutional Source Beutler Lab
Gene Symbol Slc35f5
Ensembl Gene ENSMUSG00000026342
Gene Namesolute carrier family 35, member F5
Synonyms1300003P13Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R8004 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location125560595-125595820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125589887 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 474 (H474L)
Ref Sequence ENSEMBL: ENSMUSP00000027580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027580]
Predicted Effect probably damaging
Transcript: ENSMUST00000027580
AA Change: H474L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027580
Gene: ENSMUSG00000026342
AA Change: H474L

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
transmembrane domain 69 86 N/A INTRINSIC
transmembrane domain 101 120 N/A INTRINSIC
Pfam:EamA 226 317 2.1e-8 PFAM
transmembrane domain 329 348 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 397 419 N/A INTRINSIC
transmembrane domain 421 443 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,257,210 K1070N possibly damaging Het
Ankrd24 T A 10: 81,638,357 N179K unknown Het
Atp6v0a4 A T 6: 38,050,549 F775L possibly damaging Het
Bbs2 A G 8: 94,082,490 V269A possibly damaging Het
Bpifc T G 10: 85,979,284 S273R probably benign Het
Cdan1 C T 2: 120,731,443 R20Q unknown Het
Chrm2 T A 6: 36,523,286 I26N probably damaging Het
Cngb3 A G 4: 19,505,273 K669E possibly damaging Het
Cnot1 T C 8: 95,752,752 I876V probably benign Het
Col12a1 T A 9: 79,684,401 T926S probably damaging Het
Cyp2b23 G T 7: 26,679,466 T191K probably benign Het
Dpp4 A G 2: 62,358,828 V453A probably benign Het
Eif2ak4 T C 2: 118,417,294 S271P possibly damaging Het
Fam69a T C 5: 107,909,666 D342G probably damaging Het
Fbxw20 G T 9: 109,221,381 P392H probably damaging Het
Fcho2 T A 13: 98,789,505 E118V possibly damaging Het
Gm2042 C G 12: 87,960,151 Q413E possibly damaging Het
Gm904 G A 13: 50,645,307 probably null Het
H2-D1 A G 17: 35,266,696 S352G probably benign Het
Igf2bp3 C A 6: 49,091,020 V451L probably benign Het
Igkv1-99 T C 6: 68,542,128 V23A Het
Igsf10 A G 3: 59,329,709 I1017T probably benign Het
Il18r1 G A 1: 40,474,757 C41Y probably damaging Het
Itgb4 A G 11: 115,982,705 D249G probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrn2 T A 1: 132,937,751 F185I probably damaging Het
Mllt6 G T 11: 97,676,140 E635D possibly damaging Het
Msh6 A G 17: 87,986,787 E990G probably damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Nfatc2ip A G 7: 126,390,405 V269A possibly damaging Het
Nol12 A T 15: 78,940,517 K181N probably damaging Het
Npl T A 1: 153,503,540 T266S probably benign Het
Olfr195 T A 16: 59,148,988 V46E probably damaging Het
Olfr863-ps1 A T 9: 19,942,112 D109E possibly damaging Het
Oog2 A T 4: 144,194,251 I85L probably benign Het
Parm1 A C 5: 91,594,273 S167R probably benign Het
Pcsk4 T C 10: 80,322,840 D526G probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Psmd9 T C 5: 123,241,935 probably null Het
Ralgapa1 A G 12: 55,702,457 V1220A probably damaging Het
Rbm25 A T 12: 83,674,392 E577D possibly damaging Het
S100a6 T C 3: 90,613,812 F16L probably benign Het
Sar1a C A 10: 61,685,166 H53Q probably benign Het
Setd2 G A 9: 110,592,545 A282T Het
Slc4a3 T C 1: 75,549,067 probably null Het
Smc1b G A 15: 85,097,614 S735F probably damaging Het
Sp3 A T 2: 72,970,208 I531K possibly damaging Het
St6galnac5 A T 3: 152,840,165 M252K probably damaging Het
Tas2r120 T A 6: 132,657,427 H157Q possibly damaging Het
Tbc1d10b T A 7: 127,199,011 S653C probably damaging Het
Tex10 T C 4: 48,452,047 E693G possibly damaging Het
Thada A G 17: 84,192,205 S1855P probably benign Het
Tjp2 G A 19: 24,114,120 P559L probably damaging Het
Tmem184b A G 15: 79,362,766 S368P probably damaging Het
Tnc G A 4: 63,984,657 S1461L probably benign Het
Tnpo2 T C 8: 85,044,699 F177S probably benign Het
Vmn1r58 A T 7: 5,410,507 Y241* probably null Het
Wdr66 T C 5: 123,254,450 W216R unknown Het
Other mutations in Slc35f5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Slc35f5 APN 1 125587424 missense probably damaging 1.00
IGL01844:Slc35f5 APN 1 125589875 missense probably damaging 0.96
IGL02218:Slc35f5 APN 1 125584555 missense probably damaging 1.00
IGL02586:Slc35f5 APN 1 125584536 missense probably damaging 1.00
IGL03000:Slc35f5 APN 1 125574742 missense probably damaging 1.00
IGL03160:Slc35f5 APN 1 125574735 missense probably damaging 1.00
IGL03181:Slc35f5 APN 1 125585185 missense probably damaging 1.00
IGL02984:Slc35f5 UTSW 1 125562513 missense probably benign 0.28
R0127:Slc35f5 UTSW 1 125576205 missense probably damaging 1.00
R0390:Slc35f5 UTSW 1 125585095 missense probably damaging 1.00
R0513:Slc35f5 UTSW 1 125576169 splice site probably benign
R1701:Slc35f5 UTSW 1 125570593 missense possibly damaging 0.77
R1716:Slc35f5 UTSW 1 125584532 missense possibly damaging 0.65
R2211:Slc35f5 UTSW 1 125579264 missense possibly damaging 0.74
R3024:Slc35f5 UTSW 1 125568598 missense probably benign 0.00
R3870:Slc35f5 UTSW 1 125562361 missense probably benign 0.00
R4239:Slc35f5 UTSW 1 125572474 missense possibly damaging 0.94
R4547:Slc35f5 UTSW 1 125572382 missense probably benign 0.00
R5622:Slc35f5 UTSW 1 125589956 missense probably damaging 1.00
R5688:Slc35f5 UTSW 1 125591038 missense probably benign 0.23
R5876:Slc35f5 UTSW 1 125587363 critical splice acceptor site probably null
R6701:Slc35f5 UTSW 1 125562610 missense probably damaging 1.00
R7292:Slc35f5 UTSW 1 125572485 missense probably damaging 0.99
R7368:Slc35f5 UTSW 1 125584519 missense probably damaging 1.00
R7530:Slc35f5 UTSW 1 125584538 missense probably damaging 1.00
R7807:Slc35f5 UTSW 1 125584541 missense probably damaging 1.00
Z1177:Slc35f5 UTSW 1 125560705 start gained probably benign
Z1177:Slc35f5 UTSW 1 125585234 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCATACCTGTGTTGCTTTC -3'
(R):5'- CGGGGTTACCAAGTAAAATTATAGCTC -3'

Sequencing Primer
(F):5'- CCCATCTTTCCTTTTAGAGCATTAAG -3'
(R):5'- GGAAGACATTTGACATTGGCCTC -3'
Posted On2020-01-23